Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pUC119-gRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_52255 | guide RNA targeting AtPDS3 | Arabidopsis thaliana | Ampicillin | PMID:23929339 | gRNA target sequence GGACTTTTGCCAGCCATGGT This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper. | Backbone Size:3162; Vector Backbone:pUC119; Vector Types:CRISPR, Plant expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 6 | |
|
pUASp YFP Mtl DN Resource Report Resource Website |
RRID:Addgene_52252 | Mtl | Drosophila melanogaster | Ampicillin | Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin | T20N; DN mutation | 2026-08-15 01:16:26 | 0 | ||
|
pUASp YFP Cdc42 CA Resource Report Resource Website |
RRID:Addgene_52250 | Cdc42 | Drosophila melanogaster | Ampicillin | Please note that the ORF contains a SNP at A172T. | Backbone Size:9939; Vector Backbone:pUASp; Vector Types:Insect Expression, Drosophila; Bacterial Resistance:Ampicillin | Q61L; CA mutation | 2026-08-15 01:16:21 | 0 | |
|
pSUMO1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_52258 | SUMO-1 | Homo sapiens | Streptomycin | PMID:25007328 | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | C-terminal gly-gly | 2026-08-15 01:16:26 | 6 | |
|
pTG-mTDG-K341R Resource Report Resource Website |
RRID:Addgene_52267 | TDG | Mus musculus | Ampicillin | PMID:25007328 | Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | K341R, SUMO acceptor site mutation | 2026-08-15 01:16:26 | 0 | |
|
pSC-mTDG-IntE2 Resource Report Resource Website |
RRID:Addgene_52268 | TDG | Mus musculus | Ampicillin | PMID:25007328 | Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:21 | 0 | ||
|
pSA3 Resource Report Resource Website |
RRID:Addgene_52263 | SUMO-3 | Homo sapiens | Streptomycin | PMID:25007328 | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | C-terminal gly-gly | 2026-08-15 01:16:21 | 0 | |
|
pSA1 Resource Report Resource Website |
RRID:Addgene_52261 | SUMO-1 | Homo sapiens | Streptomycin | PMID:25007328 | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | C-terminal gly-gly | 2026-08-15 01:16:26 | 0 | |
|
pSC-hTDG-K330A-IntE2 Resource Report Resource Website |
RRID:Addgene_52271 | hTDG | Homo sapiens | Ampicillin | PMID:25007328 | Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | K330A, SUMO acceptor site mutation | 2026-08-15 01:16:21 | 0 | |
|
pSC-hXRCC1-IntE2 Resource Report Resource Website |
RRID:Addgene_52276 | XRCC1 | Homo sapiens | Ampicillin | PMID:25007328 | Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 0 | ||
|
pGEX-hXRCC1-K176R Resource Report Resource Website |
RRID:Addgene_52275 | XRCC1 | Homo sapiens | Ampicillin | PMID:25007328 | Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4983; Vector Backbone:pGEX-6P-3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | K176R, SUMO acceptor site mutant | 2026-08-15 01:16:22 | 0 | |
|
pSC-hTDG-K330A-PreE2 Resource Report Resource Website |
RRID:Addgene_52273 | hTDG | Homo sapiens | Ampicillin | PMID:25007328 | Backbone Marker:New England Biolabs; Backbone Size:6707; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | K330A, SUMO acceptor site mutation | 2026-08-15 01:16:26 | 0 | |
|
pTXG-hTDG Resource Report Resource Website |
RRID:Addgene_52281 | hTDG | Homo sapiens | Ampicillin | PMID:25007328 | Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:22 | 0 | ||
|
pTXG Resource Report Resource Website |
RRID:Addgene_52280 | Ampicillin | PMID:25007328 | Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:22 | 0 | ||||
|
pBacPak-HA-Non-stop Resource Report Resource Website |
RRID:Addgene_52289 | Non-stop | Drosophila melanogaster | Ampicillin | PMID:24493646 | Vector Backbone:pBacPak; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:27 | 0 | ||
|
pBacPak-FLAG-HIS-Sgf11 Resource Report Resource Website |
RRID:Addgene_52287 | Sgf11 | Drosophila melanogaster | Ampicillin | PMID:24493646 | Vector Backbone:pBacPak; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:22 | 0 | ||
|
pBacPak-HA-E(y)2 Resource Report Resource Website |
RRID:Addgene_52288 | E(y)2 | Drosophila melanogaster | Ampicillin | PMID:24493646 | Vector Backbone:pBacPak; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:22 | 0 | ||
|
pRmHA3-CH2F2-CG9866 Resource Report Resource Website |
RRID:Addgene_52286 | Ataxin-7 | Drosophila melanogaster | Ampicillin | PMID:24493646 | Backbone Size:3991; Vector Backbone:pRmHA3; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:27 | 0 | ||
|
pTXG-hXRCC1 Resource Report Resource Website |
RRID:Addgene_52283 | XRCC1 | Homo sapiens | Ampicillin | PMID:25007328 | Backbone Marker:New England Biolabs; Backbone Size:7194; Vector Backbone:pTXB3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:22 | 0 | ||
|
F2-bio-His Resource Report Resource Website 1+ mentions |
RRID:Addgene_52179 | F2 | Homo sapiens | Ampicillin | PMID:25713122 | Article ref 161 | Backbone Marker:Yves Durocher, NRC; Backbone Size:6618; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:21 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.