Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: AcrB/AcrD/AcrFa, ABO_0964
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45434 Copy
Species: Synthetic
Genetic Insert: acrB, PSHAb_0324
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45436 Copy
Species: Synthetic
Genetic Insert: Gmet_2518
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45428 Copy
Species: Synthetic
Genetic Insert: Gmet_1652
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45429 Copy
Species: Synthetic
Genetic Insert: PSPPH_2907
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45421 Copy
Species: Synthetic
Genetic Insert: PSPPH_1196
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45424 Copy
Species: Synthetic
Genetic Insert: Rmet_1702
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45417 Copy
Species: Synthetic
Genetic Insert: Maqu_0582
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45419 Copy
Species: Synthetic
Genetic Insert: Maqu_3494
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45418 Copy
Species: Synthetic
Genetic Insert: DKAR-Nuc
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21795686
Comments: FRET-based PKD activation reporter (DKAR). Contains a PKD-specific substrate and phosphoamino acid-binding domain linking CFP and YFP. Upon phosphorylation by PKD, FRET is reduced.
Proper citation: RRID:Addgene_45499 Copy
Species: Synthetic
Genetic Insert: PFL_1028
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45413 Copy
Species: Synthetic
Genetic Insert: Rmet_4866
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45415 Copy
Species: Synthetic
Genetic Insert: PFL_1158
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21556065
Comments: Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
Proper citation: RRID:Addgene_45414 Copy
Species: Synthetic
Genetic Insert: PL2x2_5
Vector Backbone Description: Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_45491 Copy
Species: Synthetic
Genetic Insert: FR55
Vector Backbone Description: Backbone Size:5370; Vector Backbone:pET29b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_45490 Copy
Species: Synthetic
Genetic Insert: FDA60
Vector Backbone Description: Backbone Size:5358; Vector Backbone:peT21b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45606 Copy
Species: Synthetic
Genetic Insert: TALEN
Vector Backbone Description: Backbone Size:2500; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_45962 Copy
Species: Synthetic
Genetic Insert: L3S2P00 Terminator
Vector Backbone Description: Backbone Size:5047; Vector Backbone:pGR; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727987
Proper citation: RRID:Addgene_46005 Copy
Species: Synthetic
Genetic Insert: pTF promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pDONRP4P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21761975
Comments: More information can be found at http://medweb2.unige.ch/salmon/lentilab/lentivectors.html
Proper citation: RRID:Addgene_45954 Copy
Species: Synthetic
Genetic Insert: klp-12 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GATCCACAAGTTACAATTGG
Proper citation: RRID:Addgene_46170 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
