Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

328,858 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
piggybac-Syn-mScn8a-3xV5
 
Resource Report
Resource Website 		RRID:Addgene_182554 Scn8a Mus musculus Ampicillin PMID:35672149 Vector Backbone:Piggybac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:32 0
T4 Lysozyme I17A WT*
 
Resource Report
Resource Website 		RRID:Addgene_18236 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 117A WT* 2026-08-15 01:11:32 0
piggybac-Syn-mScn8a-3xHA
 
Resource Report
Resource Website 		RRID:Addgene_182555 Scn8a Mus musculus Ampicillin PMID:35672149 Vector Backbone:Piggybac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:32 0
T4 Lysozyme Y18D T26Q WT*
 
Resource Report
Resource Website 		RRID:Addgene_18239 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Y18D T26Q WT* 2026-08-15 01:11:32 0
miR-124
 
Resource Report
Resource Website 		RRID:Addgene_182363 4x miR-124 target sites Synthetic Ampicillin Four copies of miR-124 target sites (Åkerblom et al., 2012, https://doi.org/10.1523/JNEUROSCI.0558-12.2012) were cloned into “StLa” reporter plasmid (pCAG-loxP-pEM7-Neo*-bGHpA-3xSV40pA-loxP-tauLacZ-bGHpA from Nam and Benezra, 2009, https://doi.org/10.1016/j.stem.2009.08.017) without the tauLacZ insert and the Rosa26 homology arms. The 4x miR-124 target sequence can be released with BamHI and NotI. More information on the “StLa” reporter at (1) http://www.informatics.jax.org/allele/MGI:4366911 (2) https://figshare.com/ndownloader/files/38884434 (clicking this link will download a file) Backbone Marker:Hyung-song Nam, Capecchi laboratory; Vector Backbone:Custom; Vector Types:Mammalian Expression, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:11:32 0
loxP-T2A-Myr-DeadCasp8-ERT2-rox-FNF-loxP-T2A-Myr-Casp8-ERT2-rox
 
Resource Report
Resource Website 		RRID:Addgene_182360 Myr-DeadCasp8-ERT2 and Myr-Casp8-ERT2 Synthetic Ampicillin Backbone Marker:Hyung-song Nam, Capecchi laboratory; Vector Backbone:Custom; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox, Synthetic Biology, dre / rox , FLP / FRT; Bacterial Resistance:Ampicillin 2026-08-15 01:11:32 0
UAS-ras
 
Resource Report
Resource Website 		RRID:Addgene_1825 c-HA-ras Homo sapiens Ampicillin See scanned map. (Leder #C-260) Backbone Size:3900; Vector Backbone:Embl 9; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:11:32 0
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-CMVp-mito-mTFP1
 
Resource Report
Resource Website 		RRID:Addgene_182378 mtIF3 Mus musculus Ampicillin PMID:34996455 Backbone Size:3415; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant) 2026-08-15 01:11:32 0
T4 Lysozyme L33M WT*
 
Resource Report
Resource Website 		RRID:Addgene_18271 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin L33M WT* 2026-08-15 01:11:33 0
T4 Lysozyme T34A K35A S36A P37A
 
Resource Report
Resource Website 		RRID:Addgene_18272 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin T34A K35A S36A P37A 2026-08-15 01:11:33 0
T4 Lysozyme I29A I58A WT*
 
Resource Report
Resource Website 		RRID:Addgene_18263 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin I29A I58A WT* 2026-08-15 01:11:33 0
T4 Lysozyme L32T WT*
 
Resource Report
Resource Website 		RRID:Addgene_18267 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin L32T WT* 2026-08-15 01:11:33 0
T4 Lysozyme N40-[ES] WT*
 
Resource Report
Resource Website 		RRID:Addgene_18300 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin N40-[ES] WT* 2026-08-15 01:11:33 0
T4 Lysozyme R1 TA
 
Resource Report
Resource Website 		RRID:Addgene_18268 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin I17A K19S T21S E22R Y24I Y25P WT* 2026-08-15 01:11:33 0
T4 Lysozyme N40-[SLD]WT*
 
Resource Report
Resource Website 		RRID:Addgene_18301 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin N40-[SLD]WT* 2026-08-15 01:11:33 0
T4 Lysozyme L33A WT*
 
Resource Report
Resource Website 		RRID:Addgene_18269 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin L33A WT* 2026-08-15 01:11:33 0
T4 Lysozyme N40-[SLD] L46A WT*
 
Resource Report
Resource Website 		RRID:Addgene_18302 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin N40-[SLD] L46A WT* 2026-08-15 01:11:33 0
T4 Lysozyme N40L-[A] WT*
 
Resource Report
Resource Website 		RRID:Addgene_18303 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin N40L-[A] WT* 2026-08-15 01:11:33 0
T4 Lysozyme N40D WT*
 
Resource Report
Resource Website 		RRID:Addgene_18305 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin N40D WT* 2026-08-15 01:11:33 0
T4 Lysozyme A41D WT*
 
Resource Report
Resource Website 		RRID:Addgene_18306 T4 Lysozyme Bacteriophage T4 Ampicillin The BamHI site is 27 bp from the ATG and the HindIII site is 115 bp from the stop. Backbone Size:5000; Vector Backbone:pHS1403; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin A41D WT* 2026-08-15 01:11:33 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch