Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Prp16 N-terminus
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4970; Vector Backbone:pGEX2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9524131
Comments: Reed lab clone #354.
Proper citation: RRID:Addgene_11204 Copy
Species: Homo sapiens
Genetic Insert: NYESO alpha into TRAC HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA
Proper citation: RRID:Addgene_112023 Copy
Species: Homo sapiens
Genetic Insert: NYESO beta/alpha into TRAC HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA
Proper citation: RRID:Addgene_112021 Copy
Species: Homo sapiens
Genetic Insert: LC3B
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29500346
Proper citation: RRID:Addgene_112026 Copy
Species: Homo sapiens
Genetic Insert: RAB11A-GFP HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG
Proper citation: RRID:Addgene_112012 Copy
Species: Homo sapiens
Genetic Insert: CLTA-GFP HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GAACGGATCCAGCTCAGCCA
Proper citation: RRID:Addgene_112016 Copy
Species: Homo sapiens
Genetic Insert: RAB11A-mCherry HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG
Proper citation: RRID:Addgene_112013 Copy
Species: Homo sapiens
Genetic Insert: CD4-GFP HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: CTGGCCTCGTGCCTCAAATG
Proper citation: RRID:Addgene_112018 Copy
Species: Homo sapiens
Genetic Insert: Dynamin1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30069048
Proper citation: RRID:Addgene_112111 Copy
Species: Homo sapiens
Genetic Insert: Dynamin1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30069048
Proper citation: RRID:Addgene_112104 Copy
Species: Homo sapiens
Genetic Insert: ABEmax_P2A_GFP
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29813047
Proper citation: RRID:Addgene_112101 Copy
Species: Homo sapiens
Genetic Insert: Dynamin1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30069048
Proper citation: RRID:Addgene_112108 Copy
Species: Homo sapiens
Genetic Insert: Dynamin1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30069048
Proper citation: RRID:Addgene_112105 Copy
Species: Homo sapiens
Genetic Insert: Dynamin1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30069048
Proper citation: RRID:Addgene_112109 Copy
Species: Homo sapiens
Genetic Insert: Rad
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9115241
Comments: The C249 mutant contains a deletion of the calmodulin binding site and all C-terminal in vitro phosphorylation sites of Rad. Localizes mainly to cytosol in C2C12 cells (displaced from membrane).
Proper citation: RRID:Addgene_11215 Copy
Species: Homo sapiens
Genetic Insert: ACTB
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061719
Comments: 1 copy of Riboglow (variant A), flanked by restriction sites as follows: KpnI - A - BamHI
Proper citation: RRID:Addgene_112055 Copy
Species: Homo sapiens
Genetic Insert: IGF-1R
Vector Backbone Description: Backbone Size:4888; Vector Backbone:pBabe-bleo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15247278
Comments: The insert was cloned from pcDNA IGF-1R (which contains a 4.2kb IGF-1R insert that lacks about 700bp of 3' sequence. This insert was cloned into the XhoI-XbaI sites of pcDNA). An EcoRI/XbaI fragment of pcDNA-IGF-1R was then inserted into SnaBI site of pBABE-bleo (EcoRI and XbaI sites were blunted).
Proper citation: RRID:Addgene_11212 Copy
Species: Homo sapiens
Genetic Insert: U1
Vector Backbone Description: Backbone Marker: "Reduction of Target Gene Expression by a Modified U1 snRNA" (Beckley et al, 2001, Mol Cell Bio); Vector Backbone:U1 human; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30061719
Comments: In partial sequence, 1 copy of Riboglow (truncated version A)--U1 sequence is in lower case letters, Riboglow sequence is in upper case letters
Proper citation: RRID:Addgene_112059 Copy
Species: Homo sapiens
Genetic Insert: ACTB
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061719
Comments: 3 copies of Riboglow (variant A), separated by restriction sites as follows: KpnI - A - KpnI - A - BamHI - A - BamHI
Proper citation: RRID:Addgene_112057 Copy
Species: Homo sapiens
Genetic Insert: ACTB
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30061719
Comments: 4 copies of Riboglow (variant A), separated by restriction sites as follows: KpnI - A - KpnI - A - BamHI - A - BamHI - A - BamHI
Proper citation: RRID:Addgene_112058 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
