Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,857 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pDonor_mU6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_69350 mU6 promoter and sgRNA scaffold flanked by BbsI sites Kanamycin PMID:26278926 Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:Topo Blunt II; Vector Types:CRISPR; Bacterial Resistance:Kanamycin 2026-08-15 01:18:52 2
CMJ206
 
Resource Report
Resource Website 		RRID:Addgene_69529 mCherry Kanamycin PMID:26283792 Vector Backbone:pTET; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:18:52 0
CMJ205
 
Resource Report
Resource Website 		RRID:Addgene_69528 mCherry Kanamycin PMID:26283792 Vector Backbone:pTET; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:18:58 0
pTKW106alp7A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_69360 lacZ Kanamycin PMID:26019220 Addgene's NGS results identified sequence discrepancies relative to the depositor's approximate sequence provided in the annotated GenBank file. These discrepancies are not believed to impact the function of the plasmid. Vector Backbone:pTKW106; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:57 2
CMJ159
 
Resource Report
Resource Website 		RRID:Addgene_69525 PduD from Salmonella Kanamycin PMID:26283792 Vector Backbone:pTET; Vector Types:; Bacterial Resistance:Kanamycin 2026-08-15 01:18:52 0
pJL1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_69496 Super folder GFP Other Kanamycin PMID:29572528 Backbone Size:1763; Vector Backbone:pUC18; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:52 33
pBALU3
 
Resource Report
Resource Website 		RRID:Addgene_69318 CFPint-FgF Synthetic Kanamycin PMID:19259264 Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:57 0
pBALU2
 
Resource Report
Resource Website 		RRID:Addgene_69317 YFPint-FgF Synthetic Kanamycin PMID:19259264 Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:51 0
pBALU1
 
Resource Report
Resource Website 		RRID:Addgene_69316 GFPint-FgF Synthetic Kanamycin PMID:19259264 Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:51 0
pBALU6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_69321 Venus-FgF Synthetic Kanamycin PMID:19259264 Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:51 1
pBALU12
 
Resource Report
Resource Website 		RRID:Addgene_69328 gSL2-NLS-mChOint-FgF Synthetic Kanamycin PMID:19259264 Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:51 0
pBALU9
 
Resource Report
Resource Website 		RRID:Addgene_69324 gSL2-NLS-GFPint-FgF Synthetic Kanamycin PMID:19259264 Backbone Marker:Invitrogen; Vector Backbone:pCR TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:57 0
pGM190
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_69614 aphII Transposon Tn5 Kanamycin PMID:16776656 Stable replicating, multi copy shuttle vector for thiostrepton induced gene expression in Streptomyces temperature sensitive replication (G. Muth, B. Nußbaumer, W. Wohlleben and A. Pühler (1989) A vector system with temperature-sensitive replication for gene disruption and mutational cloning in streptomycetes. Mol. Gen. Genet. 219, 341-348 ) http://www.uni-tuebingen.de/en/faculties/faculty-of-science/departments/inter-faculty-institutes-and-centres/imit/units/mikrobiologiebiotechnologie/work-groups/muth/plasmids.html Backbone Size:2140; Vector Backbone:pSG5; Vector Types:Bacterial Expression, Streptomyces- E. coli shuttle vector; Bacterial Resistance:Kanamycin 2026-08-15 01:18:53 1
cpVenus-Gγ2
 
Resource Report
Resource Website 		RRID:Addgene_69626 cp173Venus-Ggamma2 Synthetic Kanamycin PMID:26799488 Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:59 0
Gβ-2A-cpV-Gγ2-IRES-Gαi3-mTq2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_69625 Gbeta-2A-cpV-Ggamma2 Synthetic Kanamycin PMID:26799488 Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:Clontech-style N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:53 3
mSTIM1_1-250-CFP
 
Resource Report
Resource Website 		RRID:Addgene_69552 mSTIM1_1-250 Mus musculus Kanamycin PMID:26184105 Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:53 0
mSTIM1_1-310-CFP
 
Resource Report
Resource Website 		RRID:Addgene_69551 mSTIM1_1-310 Mus musculus Kanamycin PMID:26184105 Backbone Size:4733; Vector Backbone:pECFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:18:53 0
p5E-Runx1+23
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_69602 Runx1 +23 intronic enhancer Mus musculus Kanamycin PMID:25594182 All PCR was performed using the High Fidelity Advantage 2 PCR Kit (Clontech). The Runx1 +23 enhancer (1) was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (XhoI and BamHI sites added) 5’-GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC-3’ and Reverse (BglII and NotI sites added) 5’- GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC -3’. The PCR fragment was gel purified, XhoI/BglII digested, ligated into XhoI/BamHI digested Tol2kit (2) #228 p5E-MCS vector and sequence verified. The mouse beta-globin minimal promoter was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (SpeI site added) 5’-GGACTAGTCCAATCTGCTCAGAGAGGACA-3’ and Reverse (SacII site added) 5’-GGCCGCGGGATGTCTGTTTCTGAGGTTGC-3’. The beta-globin minimal promoter and Runx1+23 5’ entry vector were SpeI/SacII digested and ligated together. Multisite Gateway reactions were performed according to the Invitrogen protocol. 1. Nottingham, W. T., Jarratt, A., Burgess, M., Speck, C. L., Cheng, J.-F., Prabhakar, S., et al. (2007). Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer. Blood, 110(13), 4188–4197. http://doi.org/10.1182/blood-2007-07-100883 2. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., et al. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics : an Official Publication of the American Association of Anatomists, 236(11), 3088–3099. http://doi.org/10.1002/dvdy.21343 Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pENTR attL4-R1; Vector Types:5' Gateway Entry Vector; Bacterial Resistance:Kanamycin 2026-08-15 01:18:59 4
pIC215
 
Resource Report
Resource Website 		RRID:Addgene_69736 PELP1 Homo sapiens Kanamycin Backbone Marker:Clontech; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin E927G compared to GenBank reference sequence NP_055204.3 2026-08-15 01:18:54 0
pCB52
 
Resource Report
Resource Website 		RRID:Addgene_69747 Cyclin B1 Homo sapiens Kanamycin Vector Backbone:pIC194; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Kanamycin 2026-08-15 01:18:54 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch