Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGL3 2198
 
Resource Report
Resource Website 		RRID:Addgene_49347 Bmp2 promoter (shorter sequence) Homo sapiens Ampicillin PMID:9003457 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3 basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:15:59 0
pGLB2 5'3'
 
Resource Report
Resource Website 		RRID:Addgene_49346 Bmp2 distal promoter Mus musculus Ampicillin PMID:15358784 5' region contains nt –1,237 to 471 relative to distal transcription start. 3' region contains nt 9574-11604 relative to distal transcription start and contains two Bmp2 polyadenylation signals yielding 3’UTRs of 870 and 1185 nt (Liu et al. PMID 18703506) and downstream flanking sequence. Backbone Marker:Promega; Backbone Size:5598; Vector Backbone:pGL2 basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:15:58 0
pGL1.7XX
 
Resource Report
Resource Website 		RRID:Addgene_49344 Bmp2 distal promoter Mus musculus Ampicillin PMID:14757762 Backbone Marker:Promega; Backbone Size:5598; Vector Backbone:pGL2 basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin nt –1237 to +471 2026-08-15 01:15:58 0
pHAGE NFkB-TA-LUC-UBC-GFP-W
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_49343 eGFP Ampicillin PMID:23403494 Backbone Marker:Richard Mulligan; Backbone Size:4874; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:15:59 44
pGGEV_2_XcmI-LacZ
 
Resource Report
Resource Website 		RRID:Addgene_49297 Ampicillin PMID:24116091 Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:59 0
pGGEV_+1_XcmI-LacZ
 
Resource Report
Resource Website 		RRID:Addgene_49295 Ampicillin PMID:24116091 Backbone Marker:Stratagene; Vector Backbone:pBluescript; Vector Types:cloning vector; Bacterial Resistance:Ampicillin 2026-08-15 01:15:58 0
pAc-y1sgRNA-Cas9
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49331 Cas9 Synthetic Ampicillin PMID:24326186 gRNA target sequence GGTTTTGGACACTGGAACCG Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin Human codon optimised 2026-08-15 01:15:58 4
pCAG-GBP7-p65AD
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49441 GBP7-p65 transactivation domain fusion protein Synthetic Ampicillin PMID:23953120 Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39. Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:00 1
GBK-Rab6AQ72LdeltaCSC
 
Resource Report
Resource Website 		RRID:Addgene_49558 Rab6AQ72LdeltaCSC Homo sapiens Kanamycin PMID:17908815 Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin Glutamine 72 to Leucine, deleted last 3 amino acids (CSC) 2026-08-15 01:16:00 0
GPD-roGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49436 GPD-roGFP2 Synthetic Ampicillin PMID:20019331 Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin C48S, Q80R, S147C, and Q204C in Clontech's GFP 2026-08-15 01:15:59 4
Cyto-roGFP
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_49435 roGFP2 Synthetic Ampicillin PMID:20019331 Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin C48S, Q80R, S147C, and Q204C in Clontech's GFP 2026-08-15 01:16:00 19
GBK-Rab1AQ70LdeltaCC
 
Resource Report
Resource Website 		RRID:Addgene_49555 Rab1AQ70L Homo sapiens Kanamycin PMID:17908815 Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin Glutamine 70 to Leucine, deleted amino acids Cysteine 204 and Cysteine 205 2026-08-15 01:16:00 0
pCAG-Gal4DBD-GBP2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49439 GBP2-Gal4 DNA binding domain fusion protein Synthetic Ampicillin PMID:23953120 Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39. Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:59 2
pCAG-GBP1-10gly-Gal4DBD
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49438 GBP1-Gal4 DNA binding domain fusion protein Synthetic Ampicillin PMID:23953120 The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility. Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138. Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39. Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin C98S (to increase protein solubility), Q3D 2026-08-15 01:16:00 5
GBK-Rab6BQ72LdeltaCSC
 
Resource Report
Resource Website 		RRID:Addgene_49559 Rab6BAQ72LdeltaCSC Homo sapiens Kanamycin PMID:17908815 Backbone Marker:Clontech; Backbone Size:7300; Vector Backbone:GBK-T7; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin Glutamine 72 to Leucine, deleted last 3 amino acids (CSC) 2026-08-15 01:16:01 0
EGFP-Rab11AQ70L
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49553 Rab11A Homo sapiens Kanamycin PMID:17908815 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Glutamine 70 to Leucine 2026-08-15 01:16:01 1
GFP-ATG8(416)/GFP-AUT7(416)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49425 autophagy-related 8 Saccharomyces cerevisiae Ampicillin PMID:11739783 Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:00 8
GFP-ATG8(414)/GFP-AUT7(414)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49424 autophagy-related 8 Saccharomyces cerevisiae Ampicillin PMID:12589048 Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:59 1
EGFP-Rab10T23N
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49545 Rab10T23N Homo sapiens Kanamycin PMID:20345488 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:EGFP C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Threonine 23 to Asparagine 2026-08-15 01:16:00 1
CuGFP-ATG8(416)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_49423 autophagy-related 8 Saccharomyces cerevisiae Ampicillin PMID:22977244 Backbone Size:4898; Vector Backbone:pRS416; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:59 5

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch