Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 259 showing 5161 ~ 5180 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_31606

    This resource has 1+ mentions.

http://www.addgene.org/31606

Species: Mus musculus
Genetic Insert: ΔN335 kinesin-1A
Vector Backbone Description: Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19812246

Proper citation: RRID:Addgene_31606 Copy   


  • RRID:Addgene_31675

    This resource has 1+ mentions.

http://www.addgene.org/31675

Species: Homo sapiens
Genetic Insert: BAI1-associated protein 2
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31675 Copy   


  • RRID:Addgene_31677

    This resource has 1+ mentions.

http://www.addgene.org/31677

Species: Homo sapiens
Genetic Insert: protein phosphatase 1, catalytic subunit, beta isozyme
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31677 Copy   


  • RRID:Addgene_31713

    This resource has 1+ mentions.

http://www.addgene.org/31713

Species: Homo sapiens
Genetic Insert: TACE
Vector Backbone Description: Backbone Size:4716; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19595713

Proper citation: RRID:Addgene_31713 Copy   


  • RRID:Addgene_31714

    This resource has 1+ mentions.

http://www.addgene.org/31714

Species: Homo sapiens
Genetic Insert: TACE
Vector Backbone Description: Backbone Size:4716; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19595713

Proper citation: RRID:Addgene_31714 Copy   


  • RRID:Addgene_31717

    This resource has 10+ mentions.

http://www.addgene.org/31717

Species: Homo sapiens
Genetic Insert: ADAM10
Vector Backbone Description: Backbone Size:4716; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19595713

Proper citation: RRID:Addgene_31717 Copy   


  • RRID:Addgene_31661

    This resource has 1+ mentions.

http://www.addgene.org/31661

Species: Homo sapiens
Genetic Insert: cell division cycle 27 homolog
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31661 Copy   


  • RRID:Addgene_31663

    This resource has 1+ mentions.

http://www.addgene.org/31663

Species: Homo sapiens
Genetic Insert: p21-activated protein kinase 2
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31663 Copy   


  • RRID:Addgene_31669

    This resource has 1+ mentions.

http://www.addgene.org/31669

Species: Homo sapiens
Genetic Insert: Protein Phosphatase 1 Regulatory Subunit 12A
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31669 Copy   


  • RRID:Addgene_31703

    This resource has 1+ mentions.

http://www.addgene.org/31703

Species: Mus musculus
Genetic Insert: miR-106a-363
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21454525
Comments: miR-106a-363 micro RNA sequence - caaagtgctaacagtgcaggtag

Proper citation: RRID:Addgene_31703 Copy   


  • RRID:Addgene_31654

    This resource has 1+ mentions.

http://www.addgene.org/31654

Species: Homo sapiens
Genetic Insert: protein kinase, AMP-activated, alpha 2 catalytic subunit
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31654 Copy   


  • RRID:Addgene_31657

    This resource has 1+ mentions.

http://www.addgene.org/31657

Species: Homo sapiens
Genetic Insert: BAI1-associated protein 2 S366A
Vector Backbone Description: Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22137581

Proper citation: RRID:Addgene_31657 Copy   


  • RRID:Addgene_31768

    This resource has 1+ mentions.

http://www.addgene.org/31768

Species: Homo sapiens
Genetic Insert: Trask
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5151; Vector Backbone:pcDNA4-TO-myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21559459

Proper citation: RRID:Addgene_31768 Copy   


  • RRID:Addgene_31803

    This resource has 1+ mentions.

http://www.addgene.org/31803

Species: Homo sapiens
Genetic Insert: Rab8a
Vector Backbone Description: Vector Backbone:P643_pmEGFP_N_dest.; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21310966

Proper citation: RRID:Addgene_31803 Copy   


  • RRID:Addgene_31871

    This resource has 1+ mentions.

http://www.addgene.org/31871

Species: Mus musculus
Genetic Insert: NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31871 Copy   


  • RRID:Addgene_31864

    This resource has 10+ mentions.

http://www.addgene.org/31864

Genetic Insert: 24xPP7 Stem Loop Cassette
Vector Backbone Description: Vector Backbone:pCR4blunt; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21512033
Comments: The 24xPP7 stem loop cassettes in this plasmid were generated from two non-identical stem-loops to reduce unnecessary redundancy and the chance of recombination in bacteria. The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is: taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt

Proper citation: RRID:Addgene_31864 Copy   


  • RRID:Addgene_31867

    This resource has 1+ mentions.

http://www.addgene.org/31867

Genetic Insert: LSS-mKate2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3998; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31867 Copy   


  • RRID:Addgene_31869

    This resource has 1+ mentions.

http://www.addgene.org/31869

Genetic Insert: LSS-mKate2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3983; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155

Proper citation: RRID:Addgene_31869 Copy   


  • RRID:Addgene_31851

    This resource has 1+ mentions.

http://www.addgene.org/31851

Genetic Insert: GFP (including ATG start codon)
Vector Backbone Description: Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:11250077
Comments: Plasmid can also be grown in mycobacteria.

Proper citation: RRID:Addgene_31851 Copy   


  • RRID:Addgene_31856

    This resource has 1+ mentions.

http://www.addgene.org/31856

Species: Rhodopseudomonas palustris
Genetic Insert: iRFP
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:7384; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21765402
Comments: For additional protocols on using iRFP in other tissue types please review: Verkhusha. Deep-tissue photoacoustic tomography of a genetically encoded near-infrared fluorescent probe. Angewandte Chemie Int. Ed. 2012, 51: 1448-1451. PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22213541/ For more information on in vivo imaging, please see: https://www.addgene.org/fluorescent_proteins/in_vivo/

Proper citation: RRID:Addgene_31856 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X