Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pHA-ΔN335-Kin1A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31606 ΔN335 kinesin-1A Mus musculus Ampicillin PMID:19812246 Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted amino acids 1-335 2026-08-15 01:13:34 1
pGEX-BAIAP2 wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31675 BAI1-associated protein 2 Homo sapiens Ampicillin PMID:22137581 Backbone Size:4900; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:38 1
pECE-M2-PP1Cbeta
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31677 protein phosphatase 1, catalytic subunit, beta isozyme Homo sapiens Ampicillin PMID:22137581 Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:34 3
pRK5F-TACE
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31713 TACE Homo sapiens Ampicillin PMID:19595713 Backbone Size:4716; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:34 7
pRK5M-TACE
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31714 TACE Homo sapiens Ampicillin PMID:19595713 Backbone Size:4716; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:39 3
pRK5M-ADAM10
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_31717 ADAM10 Homo sapiens Ampicillin PMID:19595713 Backbone Size:4716; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:34 17
pECE-M2-CDC27 wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31661 cell division cycle 27 homolog Homo sapiens Ampicillin PMID:22137581 Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:35 2
pECE-M2-PAK2 wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31663 p21-activated protein kinase 2 Homo sapiens Ampicillin PMID:22137581 Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:38 1
pGEX-PPP1R12A wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31669 Protein Phosphatase 1 Regulatory Subunit 12A Homo sapiens Ampicillin PMID:22137581 Backbone Size:4900; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:35 2
pMXs-MB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31703 miR-106a-363 Mus musculus Ampicillin PMID:21454525 miR-106a-363 micro RNA sequence - caaagtgctaacagtgcaggtag Backbone Size:4600; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:35 1
pECE-HA-AMPKalpha2 wt
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31654 protein kinase, AMP-activated, alpha 2 catalytic subunit Homo sapiens Ampicillin PMID:22137581 Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:35 5
pECE-M2-BAIAP2 S366A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31657 BAI1-associated protein 2 S366A Homo sapiens Ampicillin PMID:22137581 Backbone Size:2900; Vector Backbone:pECE, Addgene plasmid 26453; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin changed Serine 366 to Alanine 2026-08-15 01:13:35 1
pcDNA4-TO-myc-His wt-Trask
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31768 Trask Homo sapiens Ampicillin PMID:21559459 Backbone Marker:Invitrogen; Backbone Size:5151; Vector Backbone:pcDNA4-TO-myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:36 1
pEGFP_Rab8a
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31803 Rab8a Homo sapiens Kanamycin PMID:21310966 Vector Backbone:P643_pmEGFP_N_dest.; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:40 3
pNLS-LSSmKate2-N1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31871 NLS Mus musculus Kanamycin PMID:20212155 Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K69Y/P131T/S148G/M167D/T183S/M196V compared to mKate but numbering is relative to EGFP. 2026-08-15 01:13:36 1
pCR4-24XPP7SL
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_31864 24xPP7 Stem Loop Cassette Ampicillin PMID:21512033 The 24xPP7 stem loop cassettes in this plasmid were generated from two non-identical stem-loops to reduce unnecessary redundancy and the chance of recombination in bacteria. The sequence for a single cassette (with the two non-identical stem-loops in uppercase) is: taaggtacctaattgcctagaaaGGAGCAGACGATATGGCGTCGCTCCctgcaggtcgactctagaaa- CCAGCAGAGCATATGGGCTCGCTGGctgcagtattcccgggttcatt Vector Backbone:pCR4blunt; Vector Types:; Bacterial Resistance:Ampicillin 2026-08-15 01:13:40 15
pLSSmKate2-N1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31867 LSS-mKate2 Kanamycin PMID:20212155 Backbone Marker:Clontech; Backbone Size:3998; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K69Y/P131T/S148G/M167D/T183S/M196V 2026-08-15 01:13:40 2
pLSSmKate2-C1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31869 LSS-mKate2 Kanamycin PMID:20212155 Backbone Marker:Clontech; Backbone Size:3983; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K69Y/P131T/S148G/M167D/T183S/M196V compared to mKate but numbering is relative to EGFP. 2026-08-15 01:13:36 1
pSC301
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31851 GFP (including ATG start codon) Hygromycin PMID:11250077 Plasmid can also be grown in mycobacteria. Backbone Marker:Koen De Smet Imperial College Medical School; Backbone Size:5497; Vector Backbone:pSODIT; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin 2026-08-15 01:13:36 3
pShuttle-CMV-iRFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31856 iRFP Rhodopseudomonas palustris Kanamycin PMID:21765402 For additional protocols on using iRFP in other tissue types please review: Verkhusha. Deep-tissue photoacoustic tomography of a genetically encoded near-infrared fluorescent probe. Angewandte Chemie Int. Ed. 2012, 51: 1448-1451. PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22213541/ For more information on in vivo imaging, please see: https://www.addgene.org/fluorescent_proteins/in_vivo/ Backbone Marker:Stratagene; Backbone Size:7384; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin T2A, S13L, A92T, V104I, V114I, E161K, Y193K, F198Y, D202T, I203V, Y258F, A283V, K288T and N290Y relative to RpBphP2 2026-08-15 01:13:36 8

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch