Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pBAD/HisD-rsTagRFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31927 rsTagRFP Ampicillin PMID:20659687 Backbone Marker:Invitrogen; Backbone Size:3999; Vector Backbone:pBAD/His-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin F84W/I125L/N148A/S165G/F181L/K189N/Y200F compared to TagRFP (but numbering relative to EGFP) 2026-08-15 01:13:41 1
pMedium-FT-N1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31911 Medium-FT Kanamycin PMID:19136976 Backbone Marker:Clontech; Backbone Size:4012; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin M18L/N23D/T43S/K69R/L84W/M152I/Q194L/L205M/Y221C/R227H compared to mCherry (but numbering relative to EGFP) 2026-08-15 01:13:36 1
pTight-hMYT1L-N174
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31877 myelin transcription factor 1-like Homo sapiens Ampicillin PMID:21753754 Backbone Marker:home made/Crabtree lab; Backbone Size:7998; Vector Backbone:pTight-N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:13:36 1
pFast-FT-N1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31910 Fast-FT Kanamycin PMID:19136976 Backbone Marker:Clontech; Backbone Size:4012; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin M18V/E34K/K69R/L84W/S149T/A224S compared to mCherry (but numbering relative to EGFP) 2026-08-15 01:13:37 2
pTRE-Fast-FT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31913 Fast-FT Ampicillin PMID:19136976 Backbone Marker:Clontech; Backbone Size:3125; Vector Backbone:pTRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin M18V/E34K/K69R/L84W/S149T/A224S compared to mCherry (but numbering relative to EGFP) 2026-08-15 01:13:37 2
pMito-LSSmKate2-N1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31879 human cytochrome C oxidase subunit VIII Homo sapiens Kanamycin PMID:20212155 Backbone Marker:Clontech; Backbone Size:4646; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K69Y/P131T/S148G/M167D/T183S/M196V compared to mKate but numbering is relative to EGFP. 2026-08-15 01:13:40 1
pSlow-FT-N1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31912 Slow-FT Kanamycin PMID:19136976 Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin M18V/E30V/K69R/L84W/A179V compared to mCherry (but numbering relative to EGFP) 2026-08-15 01:13:41 3
LOVS1K
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31981 LOVS1K Homo sapiens Ampicillin PMID:21802009 Cloning primers: 5' end: CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA 3' end: CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao. Backbone Size:5000; Vector Backbone:pTriEx 3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:37 4
pcDNA5/FRT-Flag-Cul5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31984 Cul5 Homo sapiens Ampicillin PMID:18187417 Backbone Marker:Invitrogen; Backbone Size:5070; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:37 2
pDest-mCherry-N1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_31907 Chloramphenicol and Kanamycin PMID:20169111 Please note: the orientation of the MCS within this plasmid places mCherry on the c-terminus of your gene of interest. Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmcherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Kanamycin 2026-08-15 01:13:37 17
pcDNA3.1(+) Flag-His-ATM kd
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_31986 ATM kd Homo sapiens Ampicillin PMID:9733515 Do not send out as a spot on paper, send out in liquid form. Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 3'UTRf 9 nucl/D2870A N2875k. catalytically inactive. 2026-08-15 01:13:37 13
pcDNA3.1(+)Flag-His-ATM wt
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_31985 ATM wild-type Homo sapiens Ampicillin PMID:9733515 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 3' UTR of 400 nucl. 2026-08-15 01:13:42 39
pLSSmKate1-Tubulin-C1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31902 alpha-tubulin Kanamycin PMID:20212155 Backbone Marker:Clontech; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K69Y/P131T/S148G/M167E/T183S/M196V compared to mKate but numbering is relative to EGFP 2026-08-15 01:13:37 1
myc-mULK1M92A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31962 ULK1 Mus musculus Ampicillin PMID:19225151 Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin M92A 2026-08-15 01:13:41 2
myc-hULK1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_31961 ULK1 Homo sapiens Ampicillin PMID:19225151 Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:37 16
HA-hULK1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_31963 ULK1 Homo sapiens Ampicillin PMID:19225151 Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:37 14
myc-hULK2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31966 ULK2 Homo sapiens Ampicillin PMID:19225151 Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:37 4
myc-hAtg13
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31965 Atg13 Homo sapiens Ampicillin PMID:19225151 Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:41 7
HA-hAtg13
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31967 Atg13 Homo sapiens Ampicillin PMID:19225151 Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:13:37 3
mCherry-SEpHluorin
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_32001 mCherry Kanamycin PMID:20156964 Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:37 19

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch