Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: rsTagRFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3999; Vector Backbone:pBAD/His-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20659687
Proper citation: RRID:Addgene_31927 Copy
Genetic Insert: Medium-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4012; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976
Proper citation: RRID:Addgene_31911 Copy
Species: Homo sapiens
Genetic Insert: myelin transcription factor 1-like
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:7998; Vector Backbone:pTight-N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21753754
Proper citation: RRID:Addgene_31877 Copy
Genetic Insert: Fast-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4012; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976
Proper citation: RRID:Addgene_31910 Copy
Genetic Insert: Fast-FT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3125; Vector Backbone:pTRE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19136976
Proper citation: RRID:Addgene_31913 Copy
Species: Homo sapiens
Genetic Insert: human cytochrome C oxidase subunit VIII
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4646; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155
Proper citation: RRID:Addgene_31879 Copy
Genetic Insert: Slow-FT
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19136976
Proper citation: RRID:Addgene_31912 Copy
Species: Homo sapiens
Genetic Insert: LOVS1K
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx 3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21802009
Comments: Cloning primers:
5' end:
CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA
3' end:
CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG
LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao.
Proper citation: RRID:Addgene_31981 Copy
Species: Homo sapiens
Genetic Insert: Cul5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5070; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18187417
Proper citation: RRID:Addgene_31984 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmcherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:20169111
Comments: Please note: the orientation of the MCS within this plasmid places mCherry on the c-terminus of your gene of interest.
Proper citation: RRID:Addgene_31907 Copy
Species: Homo sapiens
Genetic Insert: ATM kd
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9733515
Comments: Do not send out as a spot on paper, send out in liquid form.
Proper citation: RRID:Addgene_31986 Copy
Species: Homo sapiens
Genetic Insert: ATM wild-type
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9733515
Proper citation: RRID:Addgene_31985 Copy
Genetic Insert: alpha-tubulin
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155
Proper citation: RRID:Addgene_31902 Copy
Species: Mus musculus
Genetic Insert: ULK1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19225151
Proper citation: RRID:Addgene_31962 Copy
Species: Homo sapiens
Genetic Insert: ULK1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19225151
Proper citation: RRID:Addgene_31961 Copy
Species: Homo sapiens
Genetic Insert: ULK1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19225151
Proper citation: RRID:Addgene_31963 Copy
Species: Homo sapiens
Genetic Insert: ULK2
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19225151
Proper citation: RRID:Addgene_31966 Copy
Species: Homo sapiens
Genetic Insert: Atg13
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19225151
Proper citation: RRID:Addgene_31965 Copy
Species: Homo sapiens
Genetic Insert: Atg13
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19225151
Proper citation: RRID:Addgene_31967 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20156964
Proper citation: RRID:Addgene_32001 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
