Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV_Neo; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696
Proper citation: RRID:Addgene_108103 Copy
Species: Bos taurus
Genetic Insert: PKC alpha
Vector Backbone Description: Backbone Size:4650; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12613914
Comments: Constitutively active. Myr sequence from p60src.
Proper citation: RRID:Addgene_10807 Copy
Species: Mus musculus
Genetic Insert: Egr3
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: The Egr3 gene was transferred from pcDNA3.1-Egr3 (Addgene plasmid 107998) to the pBabe(puro) retroviral vector using EcoRI and SalI sites.
Proper citation: RRID:Addgene_108102 Copy
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696
Proper citation: RRID:Addgene_108101 Copy
Species: Homo sapiens
Genetic Insert: PKD
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12637538
Comments: The HA tag on this plasmid contains a point mutation that renders it unrecognizable by the 3F10 HA antibody. It will work fine with the 12CA5 HA antibody.
The PKD insert in this plasmid contains a Myc tag inserted between amino acids 33&34, Q66R, F139S and G877W mutations when compared to GenBank reference sequence NP_002733.1. Although the effect of these mutations is unknown, this is the exact plasmid used in the associated publication and it should function as described.
Proper citation: RRID:Addgene_10809 Copy
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:7000; Vector Backbone:LentiV_puro; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696
Proper citation: RRID:Addgene_108100 Copy
Species: Rattus norvegicus
Genetic Insert: PKC zeta
Vector Backbone Description: Backbone Size:4650; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9768361
Proper citation: RRID:Addgene_10804 Copy
Species: Bos taurus
Genetic Insert: PKC alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12613914
Proper citation: RRID:Addgene_10806 Copy
Species: Homo sapiens
Genetic Insert: SIK3
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV_Neo; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696
Proper citation: RRID:Addgene_108108 Copy
Species: Mus musculus
Genetic Insert: Vmn2r120
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108087 Copy
Species: Mus musculus
Genetic Insert: Vmn2r118
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3015; Vector Backbone:pGEM-T Easy; Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108086 Copy
Species: Mus musculus
Genetic Insert: shRNA to Egr4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AAGTCTTTGGATGTGATGTTT), the annealed oligos are:
5'-gatccAAGTCTTTGGATGTGATGTTTTTCAAGAGAAAACATCACATCCAAAGACTTTTTTTTACGCGTg-----3'
3'-----gTTCAGAAACCTACACTACAAAAAGTTCTCTTTTGTAGTGTAGGTTTCTGAAAAAAAATGCGCActtaa-5'
Proper citation: RRID:Addgene_108117 Copy
Species: B. microti
Genetic Insert: BMR1_01g02031
Vector Backbone Description: Backbone Marker:Yves Durocher; Backbone Size:6670; Vector Backbone:pTT3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30367868
Proper citation: RRID:Addgene_108116 Copy
Species: Mus musculus
Genetic Insert: shRNA to Egr3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6445; Vector Backbone:pSirenRetroQ(puro); Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25535333
Comments: For the chosen sequence (AATCAATTGCCTGACAATC), the annealed oligos were:
5'-gatccAATCAATTGCCTGACAATCTTCAAGAGAGATTGTCAGGCAATTGATTTTTTTTACGCGTg-----3'
3'-gTTAGTTAACGGACTGTTAGAAGTTCTCTCTAACAGTCCGTTAACTAAAAAAAATGCGCActtaa-5'
Proper citation: RRID:Addgene_108115 Copy
Species: Mus musculus
Genetic Insert: Vmn2r1-Hprt (5')-loxP-neo
Vector Backbone Description: Backbone Marker:Agilent Technologies/Stratagene; Backbone Size:2900; Vector Backbone:pBluescript II SK+; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29465786
Proper citation: RRID:Addgene_108079 Copy
Species: Homo sapiens
Genetic Insert: LKB1
Vector Backbone Description: Backbone Size:7210; Vector Backbone:LentiV_Neo; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29526696
Proper citation: RRID:Addgene_108111 Copy
Species: Homo sapiens
Genetic Insert: PKD1 RNAi
Vector Backbone Description: Backbone Size:3176; Vector Backbone:pSUPER; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12505989
Comments: Constructed by ligation of the following oligonucleotide pairs to pSUPER: 5'-GATCCCCATG CTGTGGGGGC TGGTACTTCA AGAGAGTACC AGCCCCCACA GCATTTTTTG GAAA-3' and 5'-AGCTTTTCCA AAAAATGCTG TGGGGGCTGG TACTCTCTTG AAGTACCAGC CCCCACAGCA TGGG-3'.
Proper citation: RRID:Addgene_10815 Copy
Species: Homo sapiens
Genetic Insert: PKD
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15024053
Comments: The HA tag on this plasmid contains a point mutation that renders it unrecognizable by the 3F10 HA antibody. It will work fine with the 12CA5 HA antibody.
The PKD insert in this plasmid contains a L520P mutation when compared to GenBank reference sequence NP_002733.1. Although the effect of this mutation is unknown, this is the exact plasmid used in the associated publication and it should function as described.
Proper citation: RRID:Addgene_10814 Copy
Species: Homo sapiens
Genetic Insert: PKD
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12637538
Comments: The HA tag on this plasmid contains a point mutation that renders it unrecognizable by the 3F10 HA antibody. It will work fine with the 12CA5 HA antibody.
The PKD insert in this plasmid contains F94I, V410G and D791G mutations when compared to GenBank reference sequence NP_002733.1. Although the effect of these mutation are unknown, this is the exact plasmid used in the associated publication and it should function as described.
Proper citation: RRID:Addgene_10811 Copy
Species: Synthetic
Genetic Insert: Blue fluorescent protein (BFP2)
Vector Backbone Description: Backbone Marker:Brett Stringer; Vector Backbone:pF CAG luc IRES neo (Addgene plasmid # 98294); Vector Types:Mammalian Expression, Lentiviral, Fluorescent protein; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30894629
Proper citation: RRID:Addgene_108175 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
