Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Akt
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10226029
Comments: mAkt-HA-ER was cloned from pWZLneo-mAkt-HA-ER from kohn et al(1998) JBC 273(19)11937-11943.
Proper citation: RRID:Addgene_39530 Copy
Species: Mus musculus
Genetic Insert: Arl13b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7100; Vector Backbone:pcDNA-DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21976698
Comments: In Larkins et al (2011), this is plasmid "Arl13b untagged" as referenced in Figure 2. Full-length Arl13b with stop codon (pENTR-Arl13b1) was Gateway cloned into pcDNA-DEST40. Because of the stop codon, the backbone-encoded C-terminal tags are not expressed.
Proper citation: RRID:Addgene_40874 Copy
Species: Mus musculus
Genetic Insert: Arl13b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7100; Vector Backbone:pcDNA-DEST40; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21976698
Comments: Full-length Arl13b without a stop codon (pENTR-Arl13b2) was Gateway cloned into pcDNA-DEST40.
Proper citation: RRID:Addgene_40873 Copy
Species: Mus musculus
Genetic Insert: Arl13b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21976698
Comments: In Larkins et al (2011), this is plasmid "Arl13b GFP tagged" as referenced in Figure 2. Full-length Arl13b without a stop codon (pENTR-Arl13b2) was Gateway cloned into pcDNA-DEST47.
Proper citation: RRID:Addgene_40872 Copy
Species: Mus musculus
Genetic Insert: AMPK-γ1
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Comments: AMPK-γ1 insert has Kozak sequence embedded at 5'-terminus and a stop codon at the 3'-terminus. The FLAG of the pCMV-Tag4a backbone is out of frame.
Proper citation: RRID:Addgene_40605 Copy
Species: Mus musculus
Genetic Insert: AMPK-β2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Proper citation: RRID:Addgene_40603 Copy
Species: Mus musculus
Genetic Insert: AMPK-β1
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Proper citation: RRID:Addgene_40602 Copy
Species: Mus musculus
Genetic Insert: RPE65
Vector Backbone Description: Backbone Marker:Connie Cepko (Addgene plasmid #11159); Backbone Size:6135; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid expresses EGFP as a reporter gene from IRES as part of the bicistronic transcript
Proper citation: RRID:Addgene_41019 Copy
Species: Mus musculus
Genetic Insert: MCP-1 promoter (mutated)
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10973278
Comments: Note: Addgene NGS results identified an extra ~500 bp region upstream of the expected promoter, which contains a CMV enhancer feature. It is unknown what impact the region may have on plasmid function, but the extra sequence appears to have been present in the original sample received by Addgene.
A plasmid containing the mouse MCP-1 promoter driving luciferase (pMCP-Luc) was constructed from pGL3-basic (Promega, Madison, WI) and a PCR-generated MCP-1 promoter fragment. A proofreading competent Taq reagent (AccuTaq, Sigma) was used to ensure high fidelity PCR. 1.2 kb of the MCP-1 promoter (GenBank Accession no. U12470) was obtained by PCR of C57BL/6 mouse DNA with the following primers:
5′–TCATGTATATGGCTTTCCAGGTCT–3′ (sense strand, distal to transcription start)
5′–TGCACTTCTGGCTGCTCTGAG GCA–3′ (antisense strand, proximal to transcription start)
The PCR product terminates 28-bp downstream of the MCP-1 TATA site. XmaI and XhoI sites were added to the MCP-1 promoter by a second round of PCR with the primers:
5′–ATATCACCCGGGTCATGTATATGGCTTTCCAGGTCT–3′
5′–TAGATTCTCGAGTGCACTTCTGGCTGCTCTGAGGCA–3′
and XmaI and XhoI were used to clone the MCP-1 promoter fragment into pGL3-basic.
For the construction of the MCP-1 mutant promoter, the BCL-6 site was mutated by a two step PCR–based strategy using the above flanking primers and the following complementary primers to mutate the BCL-6 site:
5′–TCTCTCTTCCACTTCCT[TT]AAACA–3′
5′–TGTTT[AA]AGGAAGTGGAAGAGAGA–3′ (mutated bases are in brackets)
The mutant promoter was cloned into pGL3 via XhoI and XmaI. The wild-type and mutant MCP-1 promoter sequences were verified by sequencing.
Proper citation: RRID:Addgene_40325 Copy
Species: Mus musculus
Genetic Insert: AMPK-β2
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCMV-Tag5a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17012231
Comments: Does not express well. Minimal kozak only GCCATGGG.
Proper citation: RRID:Addgene_40606 Copy
Species: Mus musculus
Genetic Insert: 2C Promoter (2-cell stage promoter)
Vector Backbone Description: Backbone Marker:Invitrogen/Life Tech; Backbone Size:6400; Vector Backbone:pcDNA Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22722858
Comments: The CMV promoter from the parent pcDNA plasmid was removed with MluI and HindIII, leaving approx. 6400kb backbone. The 2C promoter was put in its place (730bp) using the same sites. Hence, the full plasmid is 7129bp. The promoter is active shortly after fertilization of mouse embryos to about the 8-cell stage. It is also on in a subset of MESCs & miPSCs.
Proper citation: RRID:Addgene_40281 Copy
Species: Mus musculus
Genetic Insert: EPLIN beta
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11179679
Proper citation: RRID:Addgene_40956 Copy
Species: Mus musculus
Genetic Insert: Ellis van Creveld syndrome 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7500; Vector Backbone:pEF5/FRT/V5-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22981989
Proper citation: RRID:Addgene_41004 Copy
Species: Mus musculus
Genetic Insert: Mouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa) S10A-YFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5368; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30478057
Proper citation: RRID:Addgene_120810 Copy
Species: Mus musculus
Genetic Insert: PACT
Vector Backbone Description: Vector Backbone:pSV40_HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_120537 Copy
Species: Mus musculus
Genetic Insert: TARBP2
Vector Backbone Description: Vector Backbone:pSV40_HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_120539 Copy
Species: Mus musculus
Genetic Insert: Truncated YPet-HP1-EV linker-ECFP-mouse histone H3
Vector Backbone Description: Backbone Size:4717; Vector Backbone:pCAGGS vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30478057
Proper citation: RRID:Addgene_120802 Copy
Species: Mus musculus
Genetic Insert: Truncated YPet-HP1-EV linker-ECFP-mouse histone H3(K9L mutation)
Vector Backbone Description: Backbone Size:4717; Vector Backbone:pCAGGS vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30478057
Proper citation: RRID:Addgene_120807 Copy
Species: Mus musculus
Genetic Insert: Mouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa)-YFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5368; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30478057
Proper citation: RRID:Addgene_120809 Copy
Species: Mus musculus
Genetic Insert: Renilla luciferase
Vector Backbone Description: Vector Backbone:phRL-SV40; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Comments: luciferase is fused with Elavl2 gene
Proper citation: RRID:Addgene_120521 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
