Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: SMC1A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pCDNA3 cMyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11877376
Proper citation: RRID:Addgene_32372 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Proper citation: RRID:Addgene_32416 Copy
Genetic Insert: oPRE
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: Gene Therapy (2006) 13, 641–645. doi:10.1038/sj.gt.3302698; published online 15 December 2005
'Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression. Schambach A, Bohne J, Baum C, Hermann FG, Egerer L, von Laer D, Giroglou T. Gene Ther. 2006 Apr;13(7):641-5.'
Addgene Sanger sequencing confirms that all four ATGs in the oPRE have been mutated to TAGs
Proper citation: RRID:Addgene_32414 Copy
Species: Mus musculus
Genetic Insert: Mdm2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15090541
Proper citation: RRID:Addgene_32365 Copy
Species: Homo sapiens
Genetic Insert: SMC1A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pCDNA3 cMyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11877376
Proper citation: RRID:Addgene_32363 Copy
Vector Backbone Description: Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Comments: Please note that Addgene's sequencing result found a 60 nucleotide insert between bp#750/751 when compared to the full plasmid sequence provided by the depositing scientist. The depositing scientist confirmed that Addgene's sequence is correct--the insertion is located downstream of the CD4 bio coding sequence and is not a concern for protein expression.
Proper citation: RRID:Addgene_32402 Copy
Vector Backbone Description: Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18296487
Comments: Please note that Addgene's sequencing result with the rCD4-F primer found a single nucleotide mismatch at bp# 858, when compared to the full plasmid sequence provided by the depositing scientist. According to the depositing scientist, this is a silent mutation in the COMP domain of the protein and should not affect protein expression.
Proper citation: RRID:Addgene_32403 Copy
Species: Mus musculus
Genetic Insert: Calcium/Calmodulin dependent protein kinase kinase beta
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21669867
Comments: A W374C mutation is also present in the pEGFP-N1-CaMKKbeta constructs that were used in this publication.
Proper citation: RRID:Addgene_32453 Copy
Genetic Insert: G-GECO1.1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21903779
Comments: Note: Could not make stable cell line using this vector.
Proper citation: RRID:Addgene_32445 Copy
Genetic Insert: G-GECO1.2
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21903779
Comments: Note: Could not make stable cell line using this vector.
Proper citation: RRID:Addgene_32446 Copy
Species: synthetic construct
Genetic Insert: R-GECO1.0
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21903779
Comments: Note: Could not make stable cell line using this vector.
Proper citation: RRID:Addgene_32444 Copy
Genetic Insert: B-GECO1.0
Vector Backbone Description: Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21903779
Comments: Note: Could not make stable cell line using this vector.
There is 1bp mismatch between Addgene's quality control sequence and the provided depositor's sequence, P5S in protein sequence. This mutation should not affect the protein function and the depositing lab confirmed that in vivo experiment before.
Proper citation: RRID:Addgene_32448 Copy
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Schmidt-Dannert Lab; Backbone Size:4138; Vector Backbone:pBBRBB; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22033566
Proper citation: RRID:Addgene_32549 Copy
Species: Homo sapiens
Genetic Insert: GSK3B
Vector Backbone Description: Backbone Marker:Sabatini Lab; Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19258413
Proper citation: RRID:Addgene_32496 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag.
Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process.
Proper citation: RRID:Addgene_32530 Copy
Species: Mus musculus
Genetic Insert: E1, ubiquitin-activating enzyme
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22012022
Proper citation: RRID:Addgene_32534 Copy
Species: Homo sapiens
Genetic Insert: Ataxin-1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9620770
Proper citation: RRID:Addgene_32492 Copy
Species: Homo sapiens
Genetic Insert: HSF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12917326
Comments: Please note that mutation P448L in HSF1 was found during Addgene's quality control. This plasmid should function as reported in the associated publication.
Proper citation: RRID:Addgene_32537 Copy
Species: Homo sapiens
Genetic Insert: HSF1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4729; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12917326
Comments: Please note that mutation P448L in HSF1 was found during Addgene's quality control. This plasmid should function as reported in the associated publication.
Proper citation: RRID:Addgene_32538 Copy
Vector Backbone Description: Backbone Marker:Mo Bi Tec; Vector Backbone:PET01; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:18930792
Proper citation: RRID:Addgene_32485 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
