Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156401 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156400 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156389 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156399 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Comments: Addgene QC identified a common point of recombination in the promoter region. Requesting scientists should screen multiple colonies by PCR using GCGTCTCTGAATGCCAGCAC and GACTGAGCTGGACAACCATG and selecting an appropriately sized clone.
Proper citation: RRID:Addgene_156394 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156397 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Proper citation: RRID:Addgene_156393 Copy
Species: Other
Genetic Insert: SpyCatcher with ddFLN4, ELP, Histag and ybbR tag
Vector Backbone Description: Backbone Size:5220; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33191756
Proper citation: RRID:Addgene_157674 Copy
Species: Other
Genetic Insert: Cohesin (R.f) with Histag and SpyTag
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pQE80l; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33191756
Proper citation: RRID:Addgene_157673 Copy
Species: Other
Genetic Insert: sMHT(1-113)-SYNZIP17
Vector Backbone Description: Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:33104325
Proper citation: RRID:Addgene_157647 Copy
Species: Other
Genetic Insert: pnGFP-Ultra, a high performance peroxynitrite sensor
Vector Backbone Description: Backbone Size:3954; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33581056
Proper citation: RRID:Addgene_157923 Copy
Species: Other
Genetic Insert: SOD2 MTS–3xHA–ND4 left TALE–G1333 DddAtox-N–1xUGI
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32641830
Proper citation: RRID:Addgene_158093 Copy
Species: Other
Genetic Insert: SOD2 MTS–3xHA–ND4 left TALE–G1397 DddAtox-N–1xUGI
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32641830
Proper citation: RRID:Addgene_158094 Copy
Species: Other
Genetic Insert: COX8A MTS–3xFLAG–ND4 right TALE–G1397 DddA tox-C–1xUGI
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32641830
Proper citation: RRID:Addgene_158097 Copy
Species: Other
Genetic Insert: COX8A MTS–3xFLAG–ND4 right TALE–G1333 DddA tox-N–1xUGI
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32641830
Proper citation: RRID:Addgene_158096 Copy
Species: Other
Genetic Insert: SARS-CoV-2 NSP8
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839
Proper citation: RRID:Addgene_158359 Copy
Species: Other
Genetic Insert: SARS-CoV-2 NSP5
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839
Proper citation: RRID:Addgene_158356 Copy
Species: Other
Genetic Insert: SARS-CoV-2 NSP6
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839
Proper citation: RRID:Addgene_158357 Copy
Species: Other
Genetic Insert: SARS-CoV-2 NSP3
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839
Proper citation: RRID:Addgene_158354 Copy
Species: Other
Genetic Insert: SARS-CoV-2 NSP1
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839
Proper citation: RRID:Addgene_158352 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.