Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 265 showing 5281 ~ 5300 out of 6,853 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/156401

Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217

Proper citation: RRID:Addgene_156401 Copy   


http://www.addgene.org/156400

Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217

Proper citation: RRID:Addgene_156400 Copy   


http://www.addgene.org/156389

Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217

Proper citation: RRID:Addgene_156389 Copy   


http://www.addgene.org/156399

Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217

Proper citation: RRID:Addgene_156399 Copy   


http://www.addgene.org/156394

Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217
Comments: Addgene QC identified a common point of recombination in the promoter region. Requesting scientists should screen multiple colonies by PCR using GCGTCTCTGAATGCCAGCAC and GACTGAGCTGGACAACCATG and selecting an appropriately sized clone.

Proper citation: RRID:Addgene_156394 Copy   


http://www.addgene.org/156397

Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217

Proper citation: RRID:Addgene_156397 Copy   


http://www.addgene.org/156393

Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Size:7469; Vector Backbone:pTYF; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31451217

Proper citation: RRID:Addgene_156393 Copy   


http://www.addgene.org/157674

Species: Other
Genetic Insert: SpyCatcher with ddFLN4, ELP, Histag and ybbR tag
Vector Backbone Description: Backbone Size:5220; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33191756

Proper citation: RRID:Addgene_157674 Copy   


http://www.addgene.org/157673

Species: Other
Genetic Insert: Cohesin (R.f) with Histag and SpyTag
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pQE80l; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33191756

Proper citation: RRID:Addgene_157673 Copy   


  • RRID:Addgene_157647

http://www.addgene.org/157647

Species: Other
Genetic Insert: sMHT(1-113)-SYNZIP17
Vector Backbone Description: Vector Backbone:p15A; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:33104325

Proper citation: RRID:Addgene_157647 Copy   


  • RRID:Addgene_157923

    This resource has 1+ mentions.

http://www.addgene.org/157923

Species: Other
Genetic Insert: pnGFP-Ultra, a high performance peroxynitrite sensor
Vector Backbone Description: Backbone Size:3954; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33581056

Proper citation: RRID:Addgene_157923 Copy   


http://www.addgene.org/158093

Species: Other
Genetic Insert: SOD2 MTS–3xHA–ND4 left TALE–G1333 DddAtox-N–1xUGI
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32641830

Proper citation: RRID:Addgene_158093 Copy   


http://www.addgene.org/158094

Species: Other
Genetic Insert: SOD2 MTS–3xHA–ND4 left TALE–G1397 DddAtox-N–1xUGI
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32641830

Proper citation: RRID:Addgene_158094 Copy   


http://www.addgene.org/158097

Species: Other
Genetic Insert: COX8A MTS–3xFLAG–ND4 right TALE–G1397 DddA tox-C–1xUGI
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32641830

Proper citation: RRID:Addgene_158097 Copy   


http://www.addgene.org/158096

Species: Other
Genetic Insert: COX8A MTS–3xFLAG–ND4 right TALE–G1333 DddA tox-N–1xUGI
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32641830

Proper citation: RRID:Addgene_158096 Copy   


  • RRID:Addgene_158359

http://www.addgene.org/158359

Species: Other
Genetic Insert: SARS-CoV-2 NSP8
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839

Proper citation: RRID:Addgene_158359 Copy   


  • RRID:Addgene_158356

http://www.addgene.org/158356

Species: Other
Genetic Insert: SARS-CoV-2 NSP5
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839

Proper citation: RRID:Addgene_158356 Copy   


  • RRID:Addgene_158357

http://www.addgene.org/158357

Species: Other
Genetic Insert: SARS-CoV-2 NSP6
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839

Proper citation: RRID:Addgene_158357 Copy   


  • RRID:Addgene_158354

http://www.addgene.org/158354

Species: Other
Genetic Insert: SARS-CoV-2 NSP3
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839

Proper citation: RRID:Addgene_158354 Copy   


  • RRID:Addgene_158352

http://www.addgene.org/158352

Species: Other
Genetic Insert: SARS-CoV-2 NSP1
Vector Backbone Description: Vector Backbone:MAC-tag-C (#108077); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32778839

Proper citation: RRID:Addgene_158352 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X