Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCDNA3 5'cMyc-SMCl- S957A/S966A Resource Report Resource Website 1+ mentions |
RRID:Addgene_32372 | SMC1A | Homo sapiens | Ampicillin | PMID:11877376 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pCDNA3 cMyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S957A/S996A | 2026-08-15 01:13:40 | 1 | |
|
pENTR-L5-mCherry-L2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32416 | mCherry | Kanamycin | PMID:21772812 | Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:41 | 1 | |||
|
pENTR-L5-oPRE-L2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32414 | oPRE | Kanamycin | PMID:21772812 | Gene Therapy (2006) 13, 641–645. doi:10.1038/sj.gt.3302698; published online 15 December 2005 'Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression. Schambach A, Bohne J, Baum C, Hermann FG, Egerer L, von Laer D, Giroglou T. Gene Ther. 2006 Apr;13(7):641-5.' Addgene Sanger sequencing confirms that all four ATGs in the oPRE have been mutated to TAGs | Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P5-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | WPRE with deletion of X protein promoter and mutation of all four ATGs which are followed by an ORF encoding more than 25 amino acids | 2026-08-15 01:13:45 | 1 | |
|
PGL3Basic-Mdm2-T1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32365 | Mdm2 promoter | Mus musculus | Ampicillin | PMID:15090541 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 1 | ||
|
pCDNA 3 5' cMyc SMC1 wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_32363 | SMC1A | Homo sapiens | Ampicillin | PMID:11877376 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pCDNA3 cMyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:40 | 2 | ||
|
CD4d3+4-bio Resource Report Resource Website 1+ mentions |
RRID:Addgene_32402 | Ampicillin | PMID:18296487 | Please note that Addgene's sequencing result found a 60 nucleotide insert between bp#750/751 when compared to the full plasmid sequence provided by the depositing scientist. The depositing scientist confirmed that Addgene's sequence is correct--the insertion is located downstream of the CD4 bio coding sequence and is not a concern for protein expression. | Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 2 | |||
|
CD4d3+4-blac Resource Report Resource Website 1+ mentions |
RRID:Addgene_32403 | Ampicillin | PMID:18296487 | Please note that Addgene's sequencing result with the rCD4-F primer found a single nucleotide mismatch at bp# 858, when compared to the full plasmid sequence provided by the depositing scientist. According to the depositing scientist, this is a silent mutation in the COMP domain of the protein and should not affect protein expression. | Backbone Marker:Mark Bushell; Backbone Size:6000; Vector Backbone:pEMCS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:45 | 1 | |||
|
pEGFP-N1-CaMKKbeta Resource Report Resource Website 1+ mentions |
RRID:Addgene_32453 | Calcium/Calmodulin dependent protein kinase kinase beta | Mus musculus | Kanamycin | PMID:21669867 | A W374C mutation is also present in the pEGFP-N1-CaMKKbeta constructs that were used in this publication. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:41 | 1 | |
|
CMV-G-GECO1.1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_32445 | G-GECO1.1 | Ampicillin | PMID:21903779 | Note: Could not make stable cell line using this vector. | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | GCaMP3 K69E/N77Y/D86G/K119I/L173Q/K380N/S404G/E430V | 2026-08-15 01:13:46 | 10 | |
|
CMV-G-GECO1.2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32446 | G-GECO1.2 | Ampicillin | PMID:21903779 | Note: Could not make stable cell line using this vector. | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | GCaMP3 K69E/N77Y/D86G/K119I/L173Q/D260G/S404G/E430V | 2026-08-15 01:13:41 | 4 | |
|
CMV-R-GECO1 Resource Report Resource Website 50+ mentions |
RRID:Addgene_32444 | R-GECO1.0 | synthetic construct | Ampicillin | PMID:21903779 | Note: Could not make stable cell line using this vector. | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Substitutions relative to the mApple-derived analogue of GCaMP3: T47A/L60P/E61V/S63V/E64S/R81G/K83R/Y134C/M158L/N164aD/V228A/ S290P/I366F/K380N/S404G/N414D/E430V | 2026-08-15 01:13:41 | 63 |
|
CMV-B-GECO1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32448 | B-GECO1.0 | Ampicillin | PMID:21903779 | Note: Could not make stable cell line using this vector. There is 1bp mismatch between Addgene's quality control sequence and the provided depositor's sequence, P5S in protein sequence. This mutation should not affect the protein function and the depositing lab confirmed that in vivo experiment before. | Backbone Size:3200; Vector Backbone:Customized Vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | GCaMP3 S40P/L60P/D86G/K119I/L173Q/T223S/Y224H/D305G/R377P/K380Q/ S404G | 2026-08-15 01:13:46 | 4 | |
|
pBBRBB-eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_32549 | eGFP | Kanamycin | PMID:22033566 | Backbone Marker:Schmidt-Dannert Lab; Backbone Size:4138; Vector Backbone:pBBRBB; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:47 | 2 | |||
|
pLKO.1-GSK3β-#1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32496 | GSK3B | Homo sapiens | Ampicillin | PMID:19258413 | Backbone Marker:Sabatini Lab; Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:41 | 7 | ||
|
pCMV-HA (New MCS) Resource Report Resource Website 10+ mentions |
RRID:Addgene_32530 | Ampicillin | Multiple cloning site (MCS) was changed from SfiI, EcoRI, SalI, BglII, XhoI, KpnI and NotI to match the MCS of the pCAGIG vector (Addgene plasmid #11159) EcoRI, XhoI, EcoRV and NotI. This changes the frame for fusion to the HA tag. Top oligo: 5'- AGGAATTCCTCGAGGATATCGC -3' and Bottom oligo 5'- GGCCGCGATATCCTCGAGGAATTCCTCCA -3' were annealed and ligated into SfiI/NotI cut pCMV-HA. The SfiI site was destroyed in the process. | Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:47 | 20 | ||||
|
pET28-mE1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_32534 | E1, ubiquitin-activating enzyme | Mus musculus | Kanamycin | PMID:22012022 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET-28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:47 | 21 | ||
|
pEGFP-ATXN1-52Q Resource Report Resource Website 1+ mentions |
RRID:Addgene_32492 | Ataxin-1 | Homo sapiens | Kanamycin | PMID:9620770 | Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | insert contains a stretch of 52 Glutamines and no stop codon | 2026-08-15 01:13:41 | 1 | |
|
FLAG-HSF1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_32537 | HSF1 | Homo sapiens | Ampicillin | PMID:12917326 | Please note that mutation P448L in HSF1 was found during Addgene's quality control. This plasmid should function as reported in the associated publication. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | see depositor comments below | 2026-08-15 01:13:42 | 13 |
|
HSF1-GFPN3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_32538 | HSF1 | Homo sapiens | Kanamycin | PMID:12917326 | Please note that mutation P448L in HSF1 was found during Addgene's quality control. This plasmid should function as reported in the associated publication. | Backbone Marker:Clontech; Backbone Size:4729; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | see depositor comments below | 2026-08-15 01:13:42 | 8 |
|
pSpliceExpress Resource Report Resource Website 10+ mentions |
RRID:Addgene_32485 | Chloramphenicol and Ampicillin | PMID:18930792 | Backbone Marker:Mo Bi Tec; Vector Backbone:PET01; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:13:41 | 16 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
