Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Schmidtea mediterranea
Genetic Insert: Smed-sped-1
Vector Backbone Description: Backbone Size:2650; Vector Backbone:pPR244; Vector Types:RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26151 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php
Proper citation: RRID:Addgene_26094 Copy
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: The pET28-MHL vector (GenBank accession EF456735) was derived from expression plasmid pET28a-LIC (SGC). It is used for T7 promoter driven expression of recombinant proteins with the addition of an 18 amino acid N-terminal fusion tag containing 6X His followed by a TEV cleavage site. The GSS residues after the Met start site were removed to reduce N-terminal gluconoylation via preventing N-terminal Met excision. Two stop codons are included in the vector at the C-terminal cloning site.
Insertion of DNA sequence into the cloning/expression region is performed using BD-Biosciences Infusion enzyme mediated directional recombination between complementary 15 nucleotide DNA sequences at the ends of the insert (PCR product) and BseRI linearized vector. Insertion of target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose.
http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php
Proper citation: RRID:Addgene_26096 Copy
Vector Backbone Description: Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843
Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: AATGGTGGTGATGATGGTGCGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.
Proper citation: RRID:Addgene_26117 Copy
Vector Backbone Description: Backbone Size:3845; Vector Backbone:pBTBXh-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20148414
Comments: There is an extra G in the middle of the alignment between Addgene's quality control sequence and the author's sequence. This discrepancy is in a non-coding region and does affect function.
Proper citation: RRID:Addgene_26078 Copy
Vector Backbone Description: Backbone Size:5076; Vector Backbone:pBMTBX-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20148414
Proper citation: RRID:Addgene_26073 Copy
Species: Homo sapiens
Genetic Insert: Tet transactivator, enhanced green fluorescent protein, TVA, rabies B19 glycoprotein
Vector Backbone Description: Backbone Marker:Mr. Gene; Backbone Size:3300; Vector Backbone:pAAV; Vector Types:AAV, Cre/Lox, Adeno-associated virus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21115815
Proper citation: RRID:Addgene_26196 Copy
Species: Homo sapiens
Genetic Insert: Mediator of DNA damage checkpoint 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2477; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_26427 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 1 isoform B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26435 Copy
Species: Homo sapiens
Genetic Insert: TAF15
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2278; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21344536
Proper citation: RRID:Addgene_26368 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2278; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21344536
Proper citation: RRID:Addgene_26367 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2278; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22081015
Proper citation: RRID:Addgene_26372 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform F (exon 1a)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26448 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform C (exon 1b)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26445 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform B (exon 1a)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCR2.1-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26447 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 1 isoform C
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26440 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform A (exon 1b)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26443 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 2 isoform E (exon 1b)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26442 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein light intermediate chain 1 N235Y
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pSC-A-amp/kan; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_26451 Copy
Species: Mus musculus
Genetic Insert: cytoplasmic dynein 1 intermediate chain 1 isoform D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3956; Vector Backbone:pCR4-TOPO; Vector Types:subcloning and sequencing; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20657784
Proper citation: RRID:Addgene_26439 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
