Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Mst1
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pJ3H; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8702870
Proper citation: RRID:Addgene_12203 Copy
Species: Homo sapiens
Genetic Insert: Mst2
Vector Backbone Description: Backbone Size:3500; Vector Backbone:pJ3H; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8702870
Comments: Addgene's QC finds additional E303D and T342M substitutions which are not known to affect function
Proper citation: RRID:Addgene_12206 Copy
Species: Homo sapiens
Genetic Insert: BRD4
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30500535
Comments: Vector contains SspB, a bacterial protein which binds exposed SsrA tag (from iLID) at high affinity.
Proper citation: RRID:Addgene_121968 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Choline kinase
Vector Backbone Description: Backbone Marker:Silva-Rocha,R., Martinez-Garcia,E., Chavarria,M., Calles,B., Arce-Rodriguez,A., de las Heras,A., Paez-Espino,D.; Backbone Size:3465; Vector Backbone:pSEVA228; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30584096
Proper citation: RRID:Addgene_122018 Copy
Species: Other
Genetic Insert: none
Vector Backbone Description: Backbone Size:6049; Vector Backbone:pUC57 and pWH1266; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:31548010
Proper citation: RRID:Addgene_122000 Copy
Genetic Insert: none
Vector Backbone Description: Backbone Size:6073; Vector Backbone:pUC57 and pWH1266; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31548010
Proper citation: RRID:Addgene_121999 Copy
Species: Homo sapiens
Genetic Insert: OCT4 - RNAi
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15749924
Comments: Target sequence: CATGTGTAAGCTGCGGCCCTT
(NM_002701: bp 642-662)
Proper citation: RRID:Addgene_12198 Copy
Species: Homo sapiens
Genetic Insert: OCT4 - RNAi
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15749924
Comments: Target sequence: GGATGTGGTCCGAGTGTGGTT (NM_002701: bp 867-887)
Proper citation: RRID:Addgene_12197 Copy
Species: Homo sapiens
Genetic Insert: Pak1
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9395435
Comments: There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way.
Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function.
Proper citation: RRID:Addgene_12208 Copy
Species: Homo sapiens
Genetic Insert: Pak1
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8798379
Comments: Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function.
Proper citation: RRID:Addgene_12207 Copy
Species: Homo sapiens
Genetic Insert: Pak1
Vector Backbone Description: Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11719502
Proper citation: RRID:Addgene_12214 Copy
Species: Homo sapiens
Genetic Insert: Pak1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_12217 Copy
Species: Homo sapiens
Genetic Insert: Pak1
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9395435
Comments: Created by 3-way ligation of PCR products: B/Sac-Sac/Eco-Eco/B.
Pak1 may contain mutations G401S and L516I. Depositor states that this should not affect plasmid function.
Proper citation: RRID:Addgene_12211 Copy
Species: Homo sapiens
Genetic Insert: Pak1
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11719502
Comments: Addgene has found that this plasmid is extremely slow growing. We recommend keeping plates and liquid cultures growing for at least 20 hours. Overnight will not be sufficient.
There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way.
Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function.
Proper citation: RRID:Addgene_12212 Copy
Species: Synthetic
Genetic Insert: rsCaMPARI
Vector Backbone Description: Backbone Size:4270; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32931424
Proper citation: RRID:Addgene_122092 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: I-SceI restriction endonuclease
Vector Backbone Description: Backbone Marker:de Lorenzo´s lab; Backbone Size:3224; Vector Backbone:pSEVA121; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30861315
Proper citation: RRID:Addgene_122095 Copy
Genetic Insert: dCas9-10X GCN4-P2A-mCherry
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30318302
Proper citation: RRID:Addgene_122132 Copy
Genetic Insert: B. subtilis Rex
Vector Backbone Description: Vector Backbone:pBBR1; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:30633862
Proper citation: RRID:Addgene_122134 Copy
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30633862
Proper citation: RRID:Addgene_122135 Copy
Genetic Insert: FBFP
Vector Backbone Description: Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:30633862
Proper citation: RRID:Addgene_122138 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
