Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDendra2-5'UTR(GAPDH)-Dendra2-3'UTR(GAPDH) Resource Report Resource Website |
RRID:Addgene_182368 | glyceraldehyde-3-phosphate dehydrogenase | Mus musculus | Kanamycin | PMID:34996455 | Backbone Size:3937; Vector Backbone:pDendra2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:12:44 | 0 | ||
|
pcDNA6-MRPS16-VN172 Resource Report Resource Website |
RRID:Addgene_182375 | Mrps16 | Mus musculus | Ampicillin | PMID:34996455 | Backbone Size:5060; Vector Backbone:pcDNA6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:12:44 | 0 | ||
|
pFLAG-Egfr(Velvet) Resource Report Resource Website 1+ mentions |
RRID:Addgene_18788 | epidermal growth factor receptor | Mus musculus | Ampicillin | PMID:15020428 | The EGFR internal signal sequence was removed during the cloning of this construct. When compared to GenBank reference sequence NP_997538.1, the signal sequence corresponds to amino acids 1-24 | Backbone Marker:Sigma; Backbone Size:6280; Vector Backbone:pFLAG-CMV3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D833G; signal sequence removed (aa1-24) | 2026-08-25 09:13:23 | 2 |
|
p3xFLAG-Tmprss6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_18789 | Type II transmembrane serine protease 6 | Mus musculus | Ampicillin | PMID:18451267 | Backbone Size:6265; Vector Backbone:p3xFLAG-CMV-14; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:23 | 1 | ||
|
TRPML2-YFP Resource Report Resource Website |
RRID:Addgene_18830 | TRPML2 | Mus musculus | Ampicillin | PMID:16606612 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:27 | 0 | ||
|
TRPML3-HA Resource Report Resource Website |
RRID:Addgene_18832 | TRPML3 | Mus musculus | Ampicillin | PMID:16606612 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:27 | 0 | ||
|
TRPML3-CFP Resource Report Resource Website |
RRID:Addgene_18834 | TRPML3 | Mus musculus | Ampicillin | PMID:16606612 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Q165R, F210Y | 2026-08-25 09:13:27 | 0 | |
|
N-Cadherin-EGFP Resource Report Resource Website 10+ mentions |
RRID:Addgene_18870 | N-Cadherin | Mus musculus | Kanamycin | PMID:17765678 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1 (Clontech); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:13:30 | 23 | ||
|
GFP-TXNIP Resource Report Resource Website 1+ mentions |
RRID:Addgene_18758 | thioredoxin-interacting protein | Mus musculus | Kanamycin | PMID:16301999 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:13:21 | 9 | ||
|
pCMV mouse sidekick2 Resource Report Resource Website |
RRID:Addgene_18735 | Sidekick-2 | Mus musculus | Kanamycin | PMID:18216854 | The NdeI-NotI fragment obtained from mKIAA1514 plasmid was cloned into the XhoI and NotI sites of EGFP-N1, and the XhoI-NdeI fragment was replaced by a cDNA amplified with primers GGCCCTCGAGTTATAAAGCAACTCGCAAAGAGG and CTGTTGTAGGCAGCCACCTCGATC. | Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:13:20 | 0 | |
|
pCMV mouse Dscam Resource Report Resource Website 1+ mentions |
RRID:Addgene_18737 | Dscam | Mus musculus | Kanamycin | PMID:18216854 | An AccI-NotI fragment from IMAGE clone 6410759 (ATCC) was cloned into the SalI/NotI sites of EGFP-N1. The AccI-AccI fragment was then replaced with cDNA amplified from mouse brain using primers GGCCGTCGACGTGGCTCGCTCGCTGGCTCGCTGGCT and CGACTCCAGCCGAGTTGTTGGCAGT. | Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEGFP-N1 (EGFP deleted); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:13:20 | 1 | |
|
pcDNA5/FRT/TO DNAJB3 Resource Report Resource Website |
RRID:Addgene_19471 | DNAJB3 | Mus musculus | Ampicillin | PMID:18686016 | Family: HSP40 Disclaimer: For cloning the various HSP genes, the Stratagene reference RNA for cDNA synthesis was used and genes were amplified from this mixture that originates from 10 different cell lines from different somatic origin and ultimately coming from 10 different individuals. This strategy was used to maximize the chance for the presence of individual HSP transcripts. Users must be aware that this mixture thus represents 20 complete haploid genomes, meaning that for each individual gene there might be polymorphisms that could potentially have functional consequences. The library was sequence verified only for the presence of the correct gene. | Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:14:11 | 0 | |
|
pGL2-NOS2Promoter-Luciferase Resource Report Resource Website 10+ mentions |
RRID:Addgene_19296 | NOS2 Promoter | Mus musculus | Ampicillin | PMID:7692452 | Backbone Marker:Promega; Backbone Size:5598; Vector Backbone:pGL2-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:57 | 11 | ||
|
mADAM17 in pcDNA3.1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_19141 | ADAM17 | Mus musculus | Ampicillin | PMID:17389606 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:46 | 4 | ||
|
MMTV-cFOS-SV40 Resource Report Resource Website 1+ mentions |
RRID:Addgene_19259 | cFOS | Mus musculus | Ampicillin | Backbone Size:3000; Vector Backbone:BSSK; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:54 | 3 | |||
|
pCMV WS myc Resource Report Resource Website |
RRID:Addgene_19274 | mouse Wrn cDNA | Mus musculus | Ampicillin | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:55 | 0 | |||
|
pABCb10-GFP Resource Report Resource Website |
RRID:Addgene_19031 | ATP-binding cassette, sub-family B (MDR/TAP), member 10 | Mus musculus | Ampicillin | PMID:15215243 | Backbone Marker:Clontech; Backbone Size:6092; Vector Backbone:pIRES; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:13:38 | 0 | ||
|
pEF-TAZ-N-Flag Resource Report Resource Website 1+ mentions |
RRID:Addgene_19025 | TAZ | Mus musculus | Ampicillin | PMID:11118213 | The murine TAZ cDNA was subcloned into pEF-BOS lacking the SV40 origin (Mizushima and Nagata, 1990) to generate pEF-TAZ. A Flag tag was inserted into the N-terminus of mTAZ cDNA by PCR, and cloned into pEF-BOS to create pEF-TAZ-N-Flag. | Backbone Size:5800; Vector Backbone:pEF-BOS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Vector has no SV40 origin | 2026-08-25 09:13:38 | 5 |
|
FLAG-RASSF1C Resource Report Resource Website 1+ mentions |
RRID:Addgene_1977 | RASSF1C | Mus musculus | Ampicillin | PMID:11857081 | Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:14:33 | 1 | ||
|
FLAG-MST1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_1965 | MST1 | Mus musculus | Ampicillin | PMID:12384512 | Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:14:23 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
