Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: Cx43
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mAzurite; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: R. norvegicus (rat) Alpha-1 Connexin 43. Excitation = 384; Emission = 450
Proper citation: RRID:Addgene_55231 Copy
Species: Homo sapiens
Genetic Insert: EB3
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 383; Emission = 448
Proper citation: RRID:Addgene_55239 Copy
Species: Homo sapiens
Genetic Insert: Fibrillarin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 383; Emission = 448
Proper citation: RRID:Addgene_55241 Copy
Species: Other
Genetic Insert: SV40 T-Antigen Nuclear Localization Signal (NLS)
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2-NLS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Nucleus = NLS. Excitation = 383; Emission = 448
Proper citation: RRID:Addgene_55249 Copy
Species: Rattus norvegicus
Genetic Insert: LAMP1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 383; Emission = 448
Proper citation: RRID:Addgene_55246 Copy
Species: Mus musculus
Genetic Insert: VASP
Vector Backbone Description: Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 383; Emission = 448
Proper citation: RRID:Addgene_55251 Copy
Species: Homo sapiens
Genetic Insert: Caveolin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: . Excitation = 399; Emission = 456
Proper citation: RRID:Addgene_55279 Copy
Species: Mus musculus
Genetic Insert: CAF1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: . Excitation = 399; Emission = 456
Proper citation: RRID:Addgene_55277 Copy
Species: Mus musculus
Genetic Insert: Wiskott-Aldrich Syndrome-like
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: . Excitation = 587; Emission = 610
Proper citation: RRID:Addgene_55164 Copy
Vector Backbone Description: Backbone Marker:Hartl et al 2001; Vector Backbone:pAX01; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24295448
Comments: This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli.
For sequencing of inserts, use the following primers:
fwd: GGCAACCGAGCGTTCTG
rev: CTGACAGCGTTTCGATCC
Proper citation: RRID:Addgene_55169 Copy
Vector Backbone Description: Backbone Marker:Guerout-Fleury, et al. 1996; Vector Backbone:pDG1662; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24295448
Comments: This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli.
For sequencing of inserts, use the following primers:
fwd: AAAGGTCATTGTTGACGCGG
rev: GAGCGTAGCGAAAAATCC
Proper citation: RRID:Addgene_55168 Copy
Species: Homo sapiens
Genetic Insert: Zyxin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: Excitation = 587; Emission = 610
May contain S11P, G42R and E62D mutations in human zyxin compared to reference sequence (NM_003461). These mutations should not affect function.
Proper citation: RRID:Addgene_55166 Copy
Species: Homo sapiens
Genetic Insert: Cx32
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: H. sapiens (human) Beta-1 Connexin 32. Excitation = 399; Emission = 456
Proper citation: RRID:Addgene_55287 Copy
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2CT-10 has a TEV-cleavable N-terminal His10-MBP fusion tag followed by Asn10. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'-TACTTCCAATCCAATGCA-3'
Reverse - 5'-TTATCCACTTCCAATGTTATTA-3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Proper citation: RRID:Addgene_55209 Copy
Species: Renilla reniformis
Genetic Insert: Renilla luciferase
Vector Backbone Description: Backbone Marker:pGreen II; Backbone Size:2500; Vector Backbone:pGreen II; Vector Types:Luciferase, Plant transient expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24510721
Proper citation: RRID:Addgene_55207 Copy
Species: Homo sapiens
Genetic Insert: ER
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: . Excitation = 399; Emission = 456
Proper citation: RRID:Addgene_55294 Copy
Species: Homo sapiens
Genetic Insert: Endosomes
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: . Excitation = 399; Emission = 456
Proper citation: RRID:Addgene_55293 Copy
Species: Homo sapiens
Genetic Insert: Dectin1A
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: . Excitation = 399; Emission = 456
Proper citation: RRID:Addgene_55290 Copy
Species: Homo sapiens
Genetic Insert: ZO1
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: . Excitation = 399; Emission = 456
Proper citation: RRID:Addgene_55335 Copy
Species: Homo sapiens
Genetic Insert: Vinculin
Vector Backbone Description: Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22174863
Comments: . Excitation = 399; Emission = 456
Proper citation: RRID:Addgene_55334 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
