Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,017 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
mAzurite-Cx43-7
 
Resource Report
Resource Website
RRID:Addgene_55231 Cx43 Rattus norvegicus Kanamycin R. norvegicus (rat) Alpha-1 Connexin 43. Excitation = 384; Emission = 450 Backbone Size:4750; Vector Backbone:mAzurite; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 0
EBFP2-EB3-7
 
Resource Report
Resource Website
RRID:Addgene_55239 EB3 Homo sapiens Kanamycin . Excitation = 383; Emission = 448 Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 0
EBFP2-Fibrillarin-7
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55241 Fibrillarin Homo sapiens Kanamycin . Excitation = 383; Emission = 448 Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin R36Q, S66F 2026-08-15 01:16:48 1
EBFP2-Nucleus-7
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55249 SV40 T-Antigen Nuclear Localization Signal (NLS) Other Kanamycin Nucleus = NLS. Excitation = 383; Emission = 448 Backbone Size:4750; Vector Backbone:EBFP2-NLS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 4
EBFP2-Lysosomes-20
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55246 LAMP1 Rattus norvegicus Kanamycin . Excitation = 383; Emission = 448 Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 3
EBFP2-VASP-5
 
Resource Report
Resource Website
RRID:Addgene_55251 VASP Mus musculus Kanamycin . Excitation = 383; Emission = 448 Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin A209T in VASP 2026-08-15 01:16:48 0
mTagBFP2-Caveolin-C-10
 
Resource Report
Resource Website
RRID:Addgene_55279 Caveolin Homo sapiens Kanamycin PMID:22174863 . Excitation = 399; Emission = 456 Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 0
mTagBFP2-CAF1-C-10
 
Resource Report
Resource Website
RRID:Addgene_55277 CAF1 Mus musculus Kanamycin PMID:22174863 . Excitation = 399; Emission = 456 Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 0
mCherry-WASP-like-N-18
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55164 Wiskott-Aldrich Syndrome-like Mus musculus Kanamycin . Excitation = 587; Emission = 610 Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:47 1
pBS2E
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55169 Ampicillin PMID:24295448 This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: GGCAACCGAGCGTTCTG rev: CTGACAGCGTTTCGATCC Backbone Marker:Hartl et al 2001; Vector Backbone:pAX01; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin 2026-08-15 01:16:47 1
pBS1C
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55168 Ampicillin PMID:24295448 This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: AAAGGTCATTGTTGACGCGG rev: GAGCGTAGCGAAAAATCC Backbone Marker:Guerout-Fleury, et al. 1996; Vector Backbone:pDG1662; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin 2026-08-15 01:16:47 1
mCherry-Zyxin-6
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55166 Zyxin Homo sapiens Kanamycin Excitation = 587; Emission = 610 May contain S11P, G42R and E62D mutations in human zyxin compared to reference sequence (NM_003461). These mutations should not affect function. Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:47 3
mTagBFP2-Cx32-7
 
Resource Report
Resource Website
RRID:Addgene_55287 Cx32 Homo sapiens Kanamycin PMID:22174863 H. sapiens (human) Beta-1 Connexin 32. Excitation = 399; Emission = 456 Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 0
pET His10 MBP Asn10 TEV LIC cloning vector (2CT-10)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55209 Ampicillin This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2CT-10 has a TEV-cleavable N-terminal His10-MBP fusion tag followed by Asn10. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'-TACTTCCAATCCAATGCA-3' Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:47 9
pGreen_dualluc_ORF_sensor
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55207 Renilla luciferase Renilla reniformis Kanamycin PMID:24510721 Backbone Marker:pGreen II; Backbone Size:2500; Vector Backbone:pGreen II; Vector Types:Luciferase, Plant transient expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:47 3
mTagBFP2-ER-5
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_55294 ER Homo sapiens Kanamycin PMID:22174863 . Excitation = 399; Emission = 456 Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin ER Signal Peptide 2026-08-15 01:16:48 2
mTagBFP2-Endosomes-14
 
Resource Report
Resource Website
RRID:Addgene_55293 Endosomes Homo sapiens Kanamycin PMID:22174863 . Excitation = 399; Emission = 456 Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 0
mTagBFP2-Dectin1A-C-10
 
Resource Report
Resource Website
RRID:Addgene_55290 Dectin1A Homo sapiens Kanamycin PMID:22174863 . Excitation = 399; Emission = 456 Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 0
mTagBFP2-ZO1-C-14
 
Resource Report
Resource Website
RRID:Addgene_55335 ZO1 Homo sapiens Kanamycin PMID:22174863 . Excitation = 399; Emission = 456 Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:48 0
mTagBFP2-Vinculin-23
 
Resource Report
Resource Website
RRID:Addgene_55334 Vinculin Homo sapiens Kanamycin PMID:22174863 . Excitation = 399; Emission = 456 Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin V234L in Vinculin. 2026-08-15 01:16:48 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.