Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
mAzurite-Cx43-7 Resource Report Resource Website |
RRID:Addgene_55231 | Cx43 | Rattus norvegicus | Kanamycin | R. norvegicus (rat) Alpha-1 Connexin 43. Excitation = 384; Emission = 450 | Backbone Size:4750; Vector Backbone:mAzurite; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 0 | ||
|
EBFP2-EB3-7 Resource Report Resource Website |
RRID:Addgene_55239 | EB3 | Homo sapiens | Kanamycin | . Excitation = 383; Emission = 448 | Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 0 | ||
|
EBFP2-Fibrillarin-7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_55241 | Fibrillarin | Homo sapiens | Kanamycin | . Excitation = 383; Emission = 448 | Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | R36Q, S66F | 2026-08-15 01:16:48 | 1 | |
|
EBFP2-Nucleus-7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_55249 | SV40 T-Antigen Nuclear Localization Signal (NLS) | Other | Kanamycin | Nucleus = NLS. Excitation = 383; Emission = 448 | Backbone Size:4750; Vector Backbone:EBFP2-NLS; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 4 | ||
|
EBFP2-Lysosomes-20 Resource Report Resource Website 1+ mentions |
RRID:Addgene_55246 | LAMP1 | Rattus norvegicus | Kanamycin | . Excitation = 383; Emission = 448 | Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 3 | ||
|
EBFP2-VASP-5 Resource Report Resource Website |
RRID:Addgene_55251 | VASP | Mus musculus | Kanamycin | . Excitation = 383; Emission = 448 | Backbone Size:4750; Vector Backbone:EBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | A209T in VASP | 2026-08-15 01:16:48 | 0 | |
|
mTagBFP2-Caveolin-C-10 Resource Report Resource Website |
RRID:Addgene_55279 | Caveolin | Homo sapiens | Kanamycin | PMID:22174863 | . Excitation = 399; Emission = 456 | Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 0 | |
|
mTagBFP2-CAF1-C-10 Resource Report Resource Website |
RRID:Addgene_55277 | CAF1 | Mus musculus | Kanamycin | PMID:22174863 | . Excitation = 399; Emission = 456 | Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 0 | |
|
mCherry-WASP-like-N-18 Resource Report Resource Website 1+ mentions |
RRID:Addgene_55164 | Wiskott-Aldrich Syndrome-like | Mus musculus | Kanamycin | . Excitation = 587; Emission = 610 | Backbone Size:4750; Vector Backbone:mCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:47 | 1 | ||
|
pBS2E Resource Report Resource Website 1+ mentions |
RRID:Addgene_55169 | Ampicillin | PMID:24295448 | This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: GGCAACCGAGCGTTCTG rev: CTGACAGCGTTTCGATCC | Backbone Marker:Hartl et al 2001; Vector Backbone:pAX01; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:47 | 1 | |||
|
pBS1C Resource Report Resource Website 1+ mentions |
RRID:Addgene_55168 | Ampicillin | PMID:24295448 | This is an “empty” vector that lacks promoters and reporter genes. The integrative part contains the flanking homology regions, a resistance cassette for selection in B. subtilis and the multiple cloning site (MCS), containing an rfp-cassette flanked by the restriction sites EcoRI, NotI, XbaI (upstream) and SpeI, NotI and PstI (downstream). They allow cloning in BioBrick standard with selection for white colonies as a result of the removal of the rfp-insert, which – if still present – leads to formation of red colonies in E. coli. For sequencing of inserts, use the following primers: fwd: AAAGGTCATTGTTGACGCGG rev: GAGCGTAGCGAAAAATCC | Backbone Marker:Guerout-Fleury, et al. 1996; Vector Backbone:pDG1662; Vector Types:Synthetic Biology, Bacillus BioBrick Box; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:47 | 1 | |||
|
mCherry-Zyxin-6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_55166 | Zyxin | Homo sapiens | Kanamycin | Excitation = 587; Emission = 610 May contain S11P, G42R and E62D mutations in human zyxin compared to reference sequence (NM_003461). These mutations should not affect function. | Backbone Size:4750; Vector Backbone:mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:47 | 3 | ||
|
mTagBFP2-Cx32-7 Resource Report Resource Website |
RRID:Addgene_55287 | Cx32 | Homo sapiens | Kanamycin | PMID:22174863 | H. sapiens (human) Beta-1 Connexin 32. Excitation = 399; Emission = 456 | Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 0 | |
|
pET His10 MBP Asn10 TEV LIC cloning vector (2CT-10) Resource Report Resource Website 1+ mentions |
RRID:Addgene_55209 | Ampicillin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system. The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z). 2CT-10 has a TEV-cleavable N-terminal His10-MBP fusion tag followed by Asn10. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag. To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers. Forward - 5'-TACTTCCAATCCAATGCA-3' Reverse - 5'-TTATCCACTTCCAATGTTATTA-3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:47 | 9 | ||||
|
pGreen_dualluc_ORF_sensor Resource Report Resource Website 1+ mentions |
RRID:Addgene_55207 | Renilla luciferase | Renilla reniformis | Kanamycin | PMID:24510721 | Backbone Marker:pGreen II; Backbone Size:2500; Vector Backbone:pGreen II; Vector Types:Luciferase, Plant transient expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:47 | 3 | ||
|
mTagBFP2-ER-5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_55294 | ER | Homo sapiens | Kanamycin | PMID:22174863 | . Excitation = 399; Emission = 456 | Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | ER Signal Peptide | 2026-08-15 01:16:48 | 2 |
|
mTagBFP2-Endosomes-14 Resource Report Resource Website |
RRID:Addgene_55293 | Endosomes | Homo sapiens | Kanamycin | PMID:22174863 | . Excitation = 399; Emission = 456 | Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 0 | |
|
mTagBFP2-Dectin1A-C-10 Resource Report Resource Website |
RRID:Addgene_55290 | Dectin1A | Homo sapiens | Kanamycin | PMID:22174863 | . Excitation = 399; Emission = 456 | Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 0 | |
|
mTagBFP2-ZO1-C-14 Resource Report Resource Website |
RRID:Addgene_55335 | ZO1 | Homo sapiens | Kanamycin | PMID:22174863 | . Excitation = 399; Emission = 456 | Backbone Size:4750; Vector Backbone:mTagBFP2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:16:48 | 0 | |
|
mTagBFP2-Vinculin-23 Resource Report Resource Website |
RRID:Addgene_55334 | Vinculin | Homo sapiens | Kanamycin | PMID:22174863 | . Excitation = 399; Emission = 456 | Backbone Size:4750; Vector Backbone:mTagBFP2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | V234L in Vinculin. | 2026-08-15 01:16:48 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
