Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pHes1(2.5k)-luc Resource Report Resource Website 1+ mentions |
RRID:Addgene_43806 | Hes1 Promoter | Mus musculus | Ampicillin | PMID:7906273 | Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Contains the murine Hes1 promoter | 2026-08-25 09:22:35 | 6 | |
|
pRK5-mWnt2 Resource Report Resource Website |
RRID:Addgene_42274 | Wnt2 | Mus musculus | Ampicillin | PMID:23095888 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:25 | 0 | ||
|
pRK5-mWnt3 Resource Report Resource Website |
RRID:Addgene_42276 | Wnt3 | Mus musculus | Ampicillin | PMID:23095888 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:25 | 0 | ||
|
pRK5-mWnt3a Resource Report Resource Website 1+ mentions |
RRID:Addgene_42277 | Wnt3a | Mus musculus | Ampicillin | PMID:23095888 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:25 | 2 | ||
|
pRK5-mWnt4 Resource Report Resource Website 1+ mentions |
RRID:Addgene_42278 | Wnt4 | Mus musculus | Ampicillin | PMID:23095888 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:25 | 1 | ||
|
K15-TK/pGL3 Resource Report Resource Website |
RRID:Addgene_44267 | K15 promoter (-4.8) | Mus musculus | Ampicillin | PMID:16288281 | Alternate plasmid name: K15-HSV-TK-pGL3 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264). The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase. The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Mouse Targeting, Thymidine kinase; Bacterial Resistance:Ampicillin | Contains the murine K15 promoter (-4.8) fragment | 2026-08-25 09:22:38 | 0 |
|
K15-EGFP Resource Report Resource Website |
RRID:Addgene_44266 | K15 promoter (-4.8) | Mus musculus | Kanamycin | PMID:15024388 | Alternate plasmid name: pEGFP-N2 K15 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2 The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII. | Backbone Marker:Clontech; Backbone Size:4737; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression, Mouse Targeting, Fluorescence microscopy; Bacterial Resistance:Kanamycin | Contains the murine K15 promoter (-4.8) fragment | 2026-08-25 09:22:38 | 0 |
|
pcDNA3 mHIF-2α MYC (P405A/P530V/N851A) Resource Report Resource Website 1+ mentions |
RRID:Addgene_44027 | mHIF-2α (P405A/P530V/N851A) | Mus musculus | Ampicillin | PMID:17804822 | This plasmid encodes an oxygen-regulation insensitive (normoxia-stable and active) full-length murine HIF-2α. Full-length murine HIF-2α cDNA was generated by reverse transcription-PCR and inserted into a pcDNA3 expression vector by using primers incorporated with restriction sites. A 10-amino-acid c-myc tag was further inserted at the C terminus of the HIF-2α cDNAs by using a Pfu-PCR-based protocol. The same Pfu-PCR protocol was then used to change residues Proline 405, Proline 530 and Asparagine 851. The newly constructed plasmid was sequenced to confirm encoding of the correct protein. This plasmid has an A94V polymorphism that does not affect protein function. Alternate plasmid names: HIF-2α triple mutant (TM); pcDNA3 HIF-2α TM | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P405A, P530V, N851A | 2026-08-25 09:22:36 | 7 |
|
pcDNA3 mHIF-1α MYC (P402A/P577A/N813A) Resource Report Resource Website 10+ mentions |
RRID:Addgene_44028 | mHIF-1α (P402A/P577A/N813A) | Mus musculus | Ampicillin | PMID:17804822 | This plasmid encodes an oxygen-regulation insensitive (normoxia-stable and active) full-length murine HIF-1α. Full-length murine HIF-1α cDNA was generated by reverse transcription-PCR and inserted into a pcDNA3 expression vector by using primers incorporated with restriction sites. A 10-amino-acid c-myc tag was further inserted at the C terminus of the HIF-1α cDNAs by using a Pfu-PCR-based protocol. The same Pfu-PCR protocol was then used to change residues Proline 402, Proline 577 and Asparagine 813 to alanines. The newly constructed plasmid was sequenced to confirm encoding of the correct protein. Alternate plasmid names: HIF-1α triple mutant (TM); pcDNA3 HIF-1α TM | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | P402A, P577A, N813A | 2026-08-25 09:22:36 | 16 |
|
Flag-p50(1-435) Resource Report Resource Website 1+ mentions |
RRID:Addgene_44747 | p50 | Mus musculus | Kanamycin | PMID:19524538 | Addgene's sequencing results identified a K352N mutation in the p50 insert sequence compared to GenBank reference sequence NP_032715.2. | Backbone Marker:Clontech; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | AA 1-435 | 2026-08-25 09:22:40 | 1 |
|
pCR3-FLAG-TRAF6-C70A Resource Report Resource Website 1+ mentions |
RRID:Addgene_43926 | TNF Receptor-Associated Factor 6 | Mus musculus | Ampicillin | PMID:17135271 | Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pCR3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C70A | 2026-08-25 09:22:36 | 1 | |
|
pcDNA3.1(+) mMff isoform 5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44601 | mMff isoform 5 | Mus musculus | Ampicillin | PMID:23283981 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:39 | 1 | ||
|
pRK6-HA-TAK1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_44160 | Tak1 | Mus musculus | Ampicillin | PMID:16260783 | Vector Backbone:pRK6-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:37 | 2 | ||
|
pCI-neo:alpha4-mcherry Resource Report Resource Website |
RRID:Addgene_45073 | alpha4-mcherry | Mus musculus | Ampicillin | PMID:21187334 | Principal Investigator Henry A. Lester α4 cloned into EcoRI sites of pCI-neo | Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:42 | 0 | |
|
pRSV-CaMKIV(1-313) Resource Report Resource Website 1+ mentions |
RRID:Addgene_45063 | Cam Kinase IV(1-313) | Mus musculus | Ampicillin | PMID:7958915 | This CaMKIV has a R128A mutation. The depositor considers this a polymorphism that is not functionally relevant. | Backbone Marker:Maurer lab; Backbone Size:4265; Vector Backbone:pRSV-link; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | truncated at amino acid 313* | 2026-08-25 09:22:42 | 1 |
|
CAG-NeuroD2iresGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45026 | NeuroD2 | Mus musculus | Ampicillin | PMID:21593321 | Backbone Marker:Matsuda & Cepko; Backbone Size:6135; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:42 | 1 | ||
|
CAG-NeuroD1iresGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_45025 | NeuroD1 | Mus musculus | Ampicillin | PMID:21593321 | Backbone Marker:Matsuda & Cepko; Backbone Size:6135; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:42 | 3 | ||
|
CAG-NeuroD6iresGFP Resource Report Resource Website |
RRID:Addgene_45027 | NeuroD6 | Mus musculus | Ampicillin | PMID:21593321 | Backbone Marker:Matsuda & Cepko; Backbone Size:6135; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:22:42 | 0 | ||
|
pUSE-Src-KD-UniRapR-mCerulean-myc Resource Report Resource Website |
RRID:Addgene_45382 | Src-KD-UniRapR-mCerulean-myc | Mus musculus | Ampicillin | PMID:23569285 | Vector Backbone:pUSE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | mSrc R388D (kinase dead), Y529F | 2026-08-25 09:22:44 | 0 | |
|
pCI-neo:Beta2meGFP Resource Report Resource Website |
RRID:Addgene_45096 | nAChR beta2 | Mus musculus | Ampicillin | PMID:21187334 | Pi ; Henry A. Lester β2 was cloned into pCI-neo at the restriction site EcoRI | Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | There are strain differences between C57BJ/6 and 129 in Chrnb2 at position 380. In C57BJ/6 it is a glutamate and in 129 it is a lysine. All of the forms of β2 currently in the lab are of the 129 variant except the β2 with GFP which was changed to a glutamate when GFP was inserted. | 2026-08-25 09:22:42 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
