Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: SpCas9-NG
Vector Backbone Description: Vector Backbone:pdCas9-bacteria; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Proper citation: RRID:Addgene_120225 Copy
Species: Escherichia coli
Genetic Insert: CRISPR spacers targeting IS1, IS5, IS3
Vector Backbone Description: Backbone Size:9326; Vector Backbone:pCRISPathBrick; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31008359
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/27/428029 for BioRxiv preprint.
Proper citation: RRID:Addgene_120425 Copy
Species: Escherichia coli
Genetic Insert: CRISPR spacers targeting IS1, IS5, IS3, IS150
Vector Backbone Description: Backbone Size:9326; Vector Backbone:pCRISPathBrick; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31008359
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/27/428029 for BioRxiv preprint.
Proper citation: RRID:Addgene_120424 Copy
Species: Synthetic
Genetic Insert: red fluorescent protein (mCherry), codon-optimized for C. difficile
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25527559
Proper citation: RRID:Addgene_120812 Copy
Species: Synthetic
Genetic Insert: red fluorescent protein (mCherry), codon-optimized for C. difficile, multiple-cloning site for protein fusion
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25527559
Proper citation: RRID:Addgene_120813 Copy
Species: Synthetic
Genetic Insert: cyan fluorescent protein, codon-optimized for low GC organisms
Vector Backbone Description: Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24727226
Proper citation: RRID:Addgene_120814 Copy
Genetic Insert: Pecf15_up436 (-60 to +20)
Vector Backbone Description: Vector Backbone:ColE2 plasmid; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30575748
Proper citation: RRID:Addgene_120893 Copy
Species: Synthetic
Genetic Insert: Noncoding sequences for CRISPR-Cas12g1
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4327; Vector Backbone:pACYC184; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30523077
Comments: For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at [email protected].
Proper citation: RRID:Addgene_120880 Copy
Genetic Insert: empty TagGFP2
Vector Backbone Description: Vector Backbone:pLenti-Origene; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31015465
Proper citation: RRID:Addgene_121426 Copy
Species: Moraxella bovoculi
Genetic Insert: MbCas12a
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:2600; Vector Backbone:CmR/p15A; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30190307
Proper citation: RRID:Addgene_115654 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8595; Vector Backbone:pPRIME-CMV-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: CMV promoter transcribes Neo and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11665 Copy
Species: Firefly
Genetic Insert: FF3
Vector Backbone Description: Backbone Size:8226; Vector Backbone:pPRIME-TET-GFP; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:16141338
Comments: TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.
Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)
Proper citation: RRID:Addgene_11662 Copy
Vector Backbone Description: Vector Backbone:pEMY11; Vector Types:Yeast Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29753070
Comments: Promoter characterization cassette for promoter expression strength when integrated into ChrXV of S. cerevisiae.
Proper citation: RRID:Addgene_127714 Copy
Species: Synthetic
Genetic Insert: Synthetic CRISPR array containing four identical T. thermophilus spacers
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3920; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31278272
Proper citation: RRID:Addgene_127764 Copy
Species: Homo sapiens
Genetic Insert: A3A-W98Y
Vector Backbone Description: Vector Backbone:pBT195; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31332326
Comments: Along with pBT195, this plasmid can be used to clone pBT361 by SapI or LguI restriction/ligation (Golden Gate). pBT361 is mutagenic in bacteria and care must be taken during cloning, handling and propagation. Benchling map: https://benchling.com/s/seq-viWaBa6R2LjXykdEZnZo
Proper citation: RRID:Addgene_127846 Copy
Genetic Insert: PSP1 target (GGTT PAM)
Vector Backbone Description: Vector Backbone:pACYC; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31171706
Proper citation: RRID:Addgene_127926 Copy
Species: From Rhodococcus sp, codon optimized for E. coli
Genetic Insert: CocE
Vector Backbone Description: Vector Backbone:pSB4C5 (iGEM registry); Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31462649
Proper citation: RRID:Addgene_128129 Copy
Species: Other
Genetic Insert: Piq - mRFP, parS
Vector Backbone Description: Vector Backbone:pSC101; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31406375
Comments: Cloning method: Golden Gate.
Proper citation: RRID:Addgene_128294 Copy
Species: Other
Genetic Insert: Piq - mRFP, BBa_J23100 - phlF, parS
Vector Backbone Description: Vector Backbone:pMB1+rop; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31406375
Comments: Cloning method: Golden Gate.
Please note: Plasmid contains a T180A mutation in mRFP. This mutation is not known to affect plasmid function.
Proper citation: RRID:Addgene_128285 Copy
Species: Other
Genetic Insert: Piq - mRFP, parS
Vector Backbone Description: Vector Backbone:pMB1+rop; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31406375
Comments: Cloning method: Golden Gate.
Proper citation: RRID:Addgene_128280 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
