Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: E. Coli
Genetic Insert: ccdb
Vector Backbone Description: Vector Backbone:pET29b+; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36108048
Proper citation: RRID:Addgene_191552 Copy
Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2390; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34820092
Proper citation: RRID:Addgene_194154 Copy
Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2754; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34820092
Proper citation: RRID:Addgene_194155 Copy
Species: E. coli
Genetic Insert: galK
Vector Backbone Description: Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_193727 Copy
Species: E. coli
Genetic Insert: human RNaseH1 D210N
Vector Backbone Description: Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:36544021
Proper citation: RRID:Addgene_196703 Copy
Species: E. coli
Genetic Insert: tRNAfMet-A37 expression cassette
Vector Backbone Description: Vector Backbone:pSEVA361; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36727459
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.05.02.490318v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196657 Copy
Species: E. coli
Genetic Insert: acrA
Vector Backbone Description: Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38270583
Proper citation: RRID:Addgene_210863 Copy
Species: E. coli
Genetic Insert: gRNA (acctggtgaagccaatattc), homologous repair template for ptsI
Vector Backbone Description: Vector Backbone:CoEi*; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38252823
Proper citation: RRID:Addgene_182960 Copy
Species: E. coli
Genetic Insert: ptsI
Vector Backbone Description: Vector Backbone:pACYC177; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38252823
Proper citation: RRID:Addgene_182963 Copy
Species: E. coli
Genetic Insert: tRNAfMet-A37G expression cassette
Vector Backbone Description: Vector Backbone:pSEVA361; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:36727459
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.05.02.490318v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196658 Copy
Species: E. coli
Genetic Insert: EcSTH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9227; Vector Backbone:pLVX-TetOne-Puro; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37884806
Proper citation: RRID:Addgene_218628 Copy
Species: E. coli
Genetic Insert: EcNR1 pUltraG ScW40 CCA trpS::ZeoR trpT::gentR dgalK lambdaRED::galK
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL)
Defining Citation: PMID:28192410
Proper citation: RRID:Addgene_218768 Copy
Species: E. coli
Genetic Insert: pUltraG ScW40CCA BL21 trpT::gentR trpS::zeoR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL)
Defining Citation: PMID:34655653
Proper citation: RRID:Addgene_218769 Copy
Species: E. coli
Genetic Insert: EcTyrRS-pAAFRS-9
Vector Backbone Description: Backbone Size:4091; Vector Backbone:pEVOL-tac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:38913984
Comments: EcY-tRNA-TAG
After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome.
Proper citation: RRID:Addgene_218767 Copy
Species: E. coli
Genetic Insert: EcWRS-h14
Vector Backbone Description: Backbone Size:4166; Vector Backbone:pEvoltac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28192410
Comments: EcW-tRNA-TGA
After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome.
Proper citation: RRID:Addgene_218764 Copy
Species: E. coli
Genetic Insert: speG
Vector Backbone Description: Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38885650
Proper citation: RRID:Addgene_220478 Copy
Species: E. coli
Genetic Insert: speG
Vector Backbone Description: Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38885650
Proper citation: RRID:Addgene_220473 Copy
Species: E. coli
Genetic Insert: Tir
Vector Backbone Description: Vector Backbone:pRetroX-TRE3G; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38925114
Proper citation: RRID:Addgene_221326 Copy
Species: E. coli
Genetic Insert: VP64
Vector Backbone Description: Backbone Marker:Michael Bassik, Lacra Bintu, Addgene #161926; Vector Backbone:pJT126; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39487265
Proper citation: RRID:Addgene_188758 Copy
Species: E. coli
Genetic Insert: CAR copy 1
Vector Backbone Description: Backbone Marker:Robertson; Backbone Size:2216; Vector Backbone:pAllet; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37345937
Proper citation: RRID:Addgene_203422 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
