Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pHR-scFv-GCN4-mStayGold-GB1-dWPRE Resource Report Resource Website |
RRID:Addgene_231598 | scFv-GCN4-mStayGold | Synthetic | Ampicillin | PMID:39892379 | Vector Backbone:pHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
pLenti-hU6-cs1-PuroR-T2A-BFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_230934 | Ampicillin | PMID:39914388 | Please visit https://doi.org/10.1101/2024.09.04.611293 for bioRxiv preprint. | Backbone Marker:Jonathan Weissman (Addgene plasmid # 122238); Vector Backbone:pBA904; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:16 | 1 | |||
|
LVDP 2P.2 Resource Report Resource Website |
RRID:Addgene_231904 | nucleocapsid protein-T2A-membrane protein-IRES-envelope protein | SARS-CoV-2 | Ampicillin | PMID:40295734 | Vector Backbone:pCSC-G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | R203M in N protein | Addgene | 2026-10-10 02:09:16 | 0 | |
|
pAAVS1-Blast-PECAM1-Neo Resource Report Resource Website |
RRID:Addgene_221149 | Platelet And Endothelial Cell Adhesion Molecule 1 | Homo sapiens | Ampicillin | PMID:38532120 | Backbone Marker:Knut Woltjen; Vector Backbone:pAAVS1-P-CAG-DEST (Plasmid #80490); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
pTlpA_mCherry_YafQ/DinJ Resource Report Resource Website |
RRID:Addgene_229148 | mCherry, DinJ/YafQ | Discosoma spp, Lacticaseibacillus casei | Erythromycin | PMID:36722614 | Addgene observed a ~1.4k base pair insertion downstream of the T7 terminator. This discrepancy does not affect plasmid function. | Backbone Marker:Addgene ; Vector Backbone:pLp_3050sNuc; Vector Types:Bacterial Expression; Bacterial Resistance:Erythromycin | Addgene | 2026-10-10 02:09:16 | 0 | |
|
pcDNA5/FRT-hMAPT Resource Report Resource Website |
RRID:Addgene_231583 | human MAPT | Homo sapiens | Ampicillin | PMID:38772368 | Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
pCfb12566 Resource Report Resource Website |
RRID:Addgene_219926 | Promoter DGA | Yarrowia lipolytica | Kanamycin | PMID:40460129 | Vector Backbone:TOPO Vector; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
pCfb12562 Resource Report Resource Website |
RRID:Addgene_219923 | Promoter GPD | Yarrowia lipolytica | Kanamycin | PMID:40460129 | Vector Backbone:TOPO Vector; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
pcDNA3-PM-deltaCKAR Resource Report Resource Website |
RRID:Addgene_222429 | Plasma membrane delta-selective C kinase activity reporter | Synthetic | Ampicillin | PMID:20959447 | Backbone Marker:Invitrogen; Backbone Size:5292; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:15 | 0 | ||
|
hSyn-eGFP-DDHD2 Resource Report Resource Website |
RRID:Addgene_232463 | DDHD2 | Homo sapiens | Ampicillin | PMID:40595405 | Backbone Size:9087; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
pEIF3D-NtermDel-CtermDel-sgEIF3D Resource Report Resource Website |
RRID:Addgene_222131 | eIF3D | Homo sapiens | Ampicillin | PMID:37144468 | Backbone Marker:Jonathan Weissman, Addgene plasmid #85996; Vector Backbone:pMJ179; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 161 + 527 truncation | Addgene | 2026-10-10 02:09:16 | 0 | |
|
TB201 Resource Report Resource Website |
RRID:Addgene_230031 | MG1655 attP21::PR-mYFP::frt | None | PMID:29355812 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
TB205 Resource Report Resource Website |
RRID:Addgene_230034 | MG1655 attP21::PR-mCherry::frt | None | PMID:28428424 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. TB205 is fliC+ and wrongly annotated as ∆fliC in PMID 28428424. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
TB204 Resource Report Resource Website |
RRID:Addgene_230033 | MG1655 attP21::PR-sfGFP::frt | None | PMID:29355812 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
TB202 Resource Report Resource Website |
RRID:Addgene_230032 | MG1655 attP21::PR-mCerulean::frt | None | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-10 02:09:16 | 0 | |||
|
TB205 △trpC Resource Report Resource Website |
RRID:Addgene_230038 | MG1655 attP21::PR-mCherry::frt trpC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
TB204 △trpC Resource Report Resource Website |
RRID:Addgene_230037 | MG1655 attP21::PR-sfGFP::frt trpC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | Addgene | 2026-10-10 02:09:16 | 0 | ||
|
PDCD1-DEM (P1#5) Resource Report Resource Website 1+ mentions |
RRID:Addgene_227738 | Designer epigenome modifier targeting PDCD1-promoter | Homo sapiens | Kanamycin | PMID:39012598 | Backbone Size:5798; Vector Backbone:pPIX; Vector Types:Mammalian Expression, Bacterial Expression, TALEN; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 02:09:17 | 1 | ||
|
LAG3-DEM (L3#1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_227739 | Designer epigenome modifier targeting LAG3-promoter (Homo sapiens) | Homo sapiens | Kanamycin | PMID:39012598 | Backbone Size:5798; Vector Backbone:pPIX; Vector Types:Mammalian Expression, Bacterial Expression, TALEN; Bacterial Resistance:Kanamycin | Addgene | 2026-10-10 02:09:17 | 1 | ||
|
AiP13600 - pAAV-AiE0528h_3xC3-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3600) Resource Report Resource Website |
RRID:Addgene_229917 | SYFP2 | Synthetic | Ampicillin | PMID:40403729 | Allen Institute plasmid alias: CN3600 | Vector Backbone:rAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | Addgene | 2026-10-10 02:09:18 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
