Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:e. coli (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

1,737 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
LM670
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_191552 ccdb E. Coli Kanamycin PMID:36108048 Vector Backbone:pET29b+; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:25:06 1
pOxyR_gfp
 
Resource Report
Resource Website 		RRID:Addgene_194154 transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP E. coli Streptomycin PMID:34820092 Backbone Marker:https://seva-plasmids.com/; Backbone Size:2390; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:25:07 0
pOxyR_rfp
 
Resource Report
Resource Website 		RRID:Addgene_194155 transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry E. coli Streptomycin PMID:34820092 Backbone Marker:https://seva-plasmids.com/; Backbone Size:2754; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin 2026-08-15 01:25:07 0
pRSFDuet-galK
 
Resource Report
Resource Website 		RRID:Addgene_193727 galK E. coli Kanamycin Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:25:09 0
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_196703 human RNaseH1 D210N E. coli Kanamycin PMID:36544021 Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin D210N, catalytically inactive 2026-08-15 01:25:17 3
ptRNAfMet-A37
 
Resource Report
Resource Website 		RRID:Addgene_196657 tRNAfMet-A37 expression cassette E. coli Chloramphenicol PMID:36727459 Please visit https://www.biorxiv.org/content/10.1101/2022.05.02.490318v1 for bioRxiv preprint. Vector Backbone:pSEVA361; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol 2026-08-15 01:25:17 0
pBbA5k-AcrAB-AsLOV2*(543)
 
Resource Report
Resource Website 		RRID:Addgene_210863 acrA E. coli Kanamycin PMID:38270583 Vector Backbone:pBbA5k; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:28:41 0
pDY281
 
Resource Report
Resource Website 		RRID:Addgene_182960 gRNA (acctggtgaagccaatattc), homologous repair template for ptsI E. coli Ampicillin PMID:38252823 Vector Backbone:CoEi*; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:28:43 0
pDY390
 
Resource Report
Resource Website 		RRID:Addgene_182963 ptsI E. coli Ampicillin PMID:38252823 Vector Backbone:pACYC177; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:28:43 0
ptRNAfMet-A37G
 
Resource Report
Resource Website 		RRID:Addgene_196658 tRNAfMet-A37G expression cassette E. coli Chloramphenicol PMID:36727459 Please visit https://www.biorxiv.org/content/10.1101/2022.05.02.490318v1 for bioRxiv preprint. Vector Backbone:pSEVA361; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol A37G in tRNAfMet 2026-08-15 01:26:03 0
pLVX-TetOne-Puro-EcSTH-FLAG
 
Resource Report
Resource Website 		RRID:Addgene_218628 EcSTH E. coli Ampicillin PMID:37884806 Backbone Marker:Clontech; Backbone Size:9227; Vector Backbone:pLVX-TetOne-Puro; Vector Types:Mammalian Expression, Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:29:59 0
ATMW1
 
Resource Report
Resource Website 		RRID:Addgene_218768 EcNR1 pUltraG ScW40 CCA trpS::ZeoR trpT::gentR dgalK lambdaRED::galK E. coli Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) PMID:28192410 Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) 2026-08-15 01:29:59 0
ATMW-BL21
 
Resource Report
Resource Website 		RRID:Addgene_218769 pUltraG ScW40CCA BL21 trpT::gentR trpS::zeoR E. coli Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) PMID:34655653 Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin (50 ug/mL), Gentamycin (10 ug/mL) 2026-08-15 01:29:59 0
pEVOL-tac-EcTyrRS-pAAFRS-9-lpp-tRNA_CUA^EcTyr
 
Resource Report
Resource Website 		RRID:Addgene_218767 EcTyrRS-pAAFRS-9 E. coli Chloramphenicol PMID:38913984 EcY-tRNA-TAG After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome. Backbone Size:4091; Vector Backbone:pEVOL-tac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol Y37G, L71V, D182C, F183Y, L186C, D265R 2026-08-15 01:30:01 0
pEvoltac-EcW-TGA-h14
 
Resource Report
Resource Website 		RRID:Addgene_218764 EcWRS-h14 E. coli Chloramphenicol PMID:28192410 EcW-tRNA-TGA After the plasmids are propagated, they need to be gel purified by agarose gel because the ATM strains contain a plasmid in their genome. Backbone Size:4166; Vector Backbone:pEvoltac; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol S8A, V144G, V146C 2026-08-15 01:30:01 0
pET28a_speG_Nterm_His
 
Resource Report
Resource Website 		RRID:Addgene_220478 speG E. coli Kanamycin PMID:38885650 Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin none 2026-08-15 01:30:09 0
pTrcHis_VectorA_short_speG_genomic
 
Resource Report
Resource Website 		RRID:Addgene_220473 speG E. coli Ampicillin PMID:38885650 Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin none 2026-08-15 01:30:06 0
pRetroX-TRE3G-Tir
 
Resource Report
Resource Website 		RRID:Addgene_221326 Tir E. coli Ampicillin PMID:38925114 Vector Backbone:pRetroX-TRE3G; Vector Types:Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:30:13 0
pJT218 lenti pEF-rTetR(SE-G72P)-3XFLAG-VP64-T2A-mCherry-BSD-WPRE
 
Resource Report
Resource Website 		RRID:Addgene_188758 VP64 E. coli Ampicillin PMID:39487265 Backbone Marker:Michael Bassik, Lacra Bintu, Addgene #161926; Vector Backbone:pJT126; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:29:40 0
pWR88
 
Resource Report
Resource Website 		RRID:Addgene_203422 CAR copy 1 E. coli Ampicillin PMID:37345937 Backbone Marker:Robertson; Backbone Size:2216; Vector Backbone:pAllet; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:29:41 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch