Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: scFv-GCN4-mStayGold
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39892379
Proper citation: RRID:Addgene_231598 Copy
Vector Backbone Description: Backbone Marker:Jonathan Weissman (Addgene plasmid # 122238); Vector Backbone:pBA904; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39914388
Comments: Please visit https://doi.org/10.1101/2024.09.04.611293 for bioRxiv preprint.
Proper citation: RRID:Addgene_230934 Copy
Species: SARS-CoV-2
Genetic Insert: nucleocapsid protein-T2A-membrane protein-IRES-envelope protein
Vector Backbone Description: Vector Backbone:pCSC-G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40295734
Proper citation: RRID:Addgene_231904 Copy
Species: Homo sapiens
Genetic Insert: Platelet And Endothelial Cell Adhesion Molecule 1
Vector Backbone Description: Backbone Marker:Knut Woltjen; Vector Backbone:pAAVS1-P-CAG-DEST (Plasmid #80490); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38532120
Proper citation: RRID:Addgene_221149 Copy
Species: Discosoma spp, Lacticaseibacillus casei
Genetic Insert: mCherry, DinJ/YafQ
Vector Backbone Description: Backbone Marker:Addgene ; Vector Backbone:pLp_3050sNuc; Vector Types:Bacterial Expression; Bacterial Resistance:Erythromycin
Defining Citation: PMID:36722614
Comments: Addgene observed a ~1.4k base pair insertion downstream of the T7 terminator. This discrepancy does not affect plasmid function.
Proper citation: RRID:Addgene_229148 Copy
Species: Homo sapiens
Genetic Insert: human MAPT
Vector Backbone Description: Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38772368
Proper citation: RRID:Addgene_231583 Copy
Species: Yarrowia lipolytica
Genetic Insert: Promoter DGA
Vector Backbone Description: Vector Backbone:TOPO Vector; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40460129
Proper citation: RRID:Addgene_219926 Copy
Species: Yarrowia lipolytica
Genetic Insert: Promoter GPD
Vector Backbone Description: Vector Backbone:TOPO Vector; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40460129
Proper citation: RRID:Addgene_219923 Copy
Species: Synthetic
Genetic Insert: Plasma membrane delta-selective C kinase activity reporter
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5292; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20959447
Proper citation: RRID:Addgene_222429 Copy
Species: Homo sapiens
Genetic Insert: DDHD2
Vector Backbone Description: Backbone Size:9087; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40595405
Proper citation: RRID:Addgene_232463 Copy
Species: Homo sapiens
Genetic Insert: eIF3D
Vector Backbone Description: Backbone Marker:Jonathan Weissman, Addgene plasmid #85996; Vector Backbone:pMJ179; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37144468
Proper citation: RRID:Addgene_222131 Copy
Genetic Insert: MG1655 attP21::PR-mYFP::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29355812
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230031 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:28428424
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. TB205 is fliC+ and wrongly annotated as ∆fliC in PMID 28428424.
Proper citation: RRID:Addgene_230034 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29355812
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230033 Copy
Genetic Insert: MG1655 attP21::PR-mCerulean::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Comments: Strain Validation: Fluorescence, PCR for fluorescent marker gene.
Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid.
Proper citation: RRID:Addgene_230032 Copy
Genetic Insert: MG1655 attP21::PR-mCherry::frt trpC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
trpC_fwd: AACGTCGCCATGTTAATGCG
trpC_rev: GAACTGAGCCTGAAATTCAGG
Proper citation: RRID:Addgene_230038 Copy
Genetic Insert: MG1655 attP21::PR-sfGFP::frt trpC::frt
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:32042125
Comments: Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
trpC_fwd: AACGTCGCCATGTTAATGCG
trpC_rev: GAACTGAGCCTGAAATTCAGG
Proper citation: RRID:Addgene_230037 Copy
Species: Homo sapiens
Genetic Insert: Designer epigenome modifier targeting PDCD1-promoter
Vector Backbone Description: Backbone Size:5798; Vector Backbone:pPIX; Vector Types:Mammalian Expression, Bacterial Expression, TALEN; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39012598
Proper citation: RRID:Addgene_227738 Copy
Species: Homo sapiens
Genetic Insert: Designer epigenome modifier targeting LAG3-promoter (Homo sapiens)
Vector Backbone Description: Backbone Size:5798; Vector Backbone:pPIX; Vector Types:Mammalian Expression, Bacterial Expression, TALEN; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39012598
Proper citation: RRID:Addgene_227739 Copy
Species: Synthetic
Genetic Insert: SYFP2
Vector Backbone Description: Vector Backbone:rAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40403729
Comments: Allen Institute plasmid alias: CN3600
Proper citation: RRID:Addgene_229917 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
