Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: a novel protein kinase structurally related to C. elegans UNC-51
Vector Backbone Description: Backbone Size:3410; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9600096
Proper citation: RRID:Addgene_22897 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:R. Armstrong; Backbone Size:5635; Vector Backbone:pIRESRed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:14962745
Comments: Mu Myt1 complete sequence includes 7 Zn Fingers and a Myc Tag. This was subcloned into pIRES/Red made by R. A. Armstrong. The DsRed does not express due to problem with IRES
This Myt1-7zf DNA was cut from the full-length clone (pMycMyt1-7zf) which was a gift of Dr. Jacob Hecksher-Sorensen.
Proper citation: RRID:Addgene_22652 Copy
Species: Mus musculus
Genetic Insert: Ror2 delta Ig
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19720827
Proper citation: RRID:Addgene_22629 Copy
Species: Mus musculus
Genetic Insert: Ror2 delta Pro
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19720827
Proper citation: RRID:Addgene_22634 Copy
Species: Mus musculus
Genetic Insert: PIF6APB
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19749742
Proper citation: RRID:Addgene_22474 Copy
Species: Mus musculus
Genetic Insert: Ror2 delta Kringle
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19720827
Proper citation: RRID:Addgene_22630 Copy
Species: Mus musculus
Genetic Insert: PPARalpha
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4000; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The PPARa cDNA was isolated from an adipocyte lambda ZAPII cDNA library (Tontonoz et al 1994 Genes Dev 8:1224-1234).
Proper citation: RRID:Addgene_22751 Copy
Species: Mus musculus
Genetic Insert: PhyB NT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19749742
Proper citation: RRID:Addgene_22471 Copy
Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Comments: This plasmid is identical to pId1-IRES-Venus (Plasmid #22663).
Proper citation: RRID:Addgene_22667 Copy
Species: Mus musculus
Genetic Insert: autophagy related genes 5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11266458
Proper citation: RRID:Addgene_22958 Copy
Species: Mus musculus
Genetic Insert: autophagy related genes 5
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11266458
Proper citation: RRID:Addgene_22956 Copy
Species: Mus musculus
Genetic Insert: Mfn1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pcDNA3.1(-)/Myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12527753
Proper citation: RRID:Addgene_23212 Copy
Species: Mus musculus
Genetic Insert: IKK alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9710600
Proper citation: RRID:Addgene_23296 Copy
Species: Mus musculus
Genetic Insert: IKK alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9710600
Proper citation: RRID:Addgene_23297 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TD)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23092 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TA)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23093 Copy
Species: Mus musculus
Genetic Insert: c-src
Vector Backbone Description: Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9343417
Comments: This clone was assembled from multiple PCR products by using the following
primers, described by their sequence relationship to the transcribed DUP RNA.
DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33
exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo-
gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT
GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2
and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is
homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT
GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6
(TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron
1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA
GAA) also contains the ApaI site and is complementary to intron 1 and primer
DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon
1. A series of PCRs was performed with the following primers and templates.
Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4,
5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the
1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8
PCR products as templates. A final PCR assembled a complete fragment by
using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final
PCR product was cleaved with NsiI and DraIII and inserted into the CMV
DUP33 vector also cleaved with NsiI and DraIII. This clone was designated
DUP4-1.
Proper citation: RRID:Addgene_23022 Copy
Species: Mus musculus
Genetic Insert: Bim EL
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23090 Copy
Species: Mus musculus
Genetic Insert: DLC2
Vector Backbone Description: Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12591950
Proper citation: RRID:Addgene_24269 Copy
Species: Mus musculus
Genetic Insert: nAChR beta2 WT
Vector Backbone Description: Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14684858
Proper citation: RRID:Addgene_24272 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
