Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pME18S-3HA-mULK1(K46N) Resource Report Resource Website 1+ mentions |
RRID:Addgene_22897 | a novel protein kinase structurally related to C. elegans UNC-51 | Mus musculus | Ampicillin | PMID:9600096 | Backbone Size:3410; Vector Backbone:pME18s; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | changed Lysine 46 to Aspargine | 2026-08-25 09:18:11 | 2 | |
|
pMycMyt1-7zf/IRES-Red Resource Report Resource Website 1+ mentions |
RRID:Addgene_22652 | Myelin Transcription Factor 1 | Mus musculus | Kanamycin | PMID:14962745 | Mu Myt1 complete sequence includes 7 Zn Fingers and a Myc Tag. This was subcloned into pIRES/Red made by R. A. Armstrong. The DsRed does not express due to problem with IRES This Myt1-7zf DNA was cut from the full-length clone (pMycMyt1-7zf) which was a gift of Dr. Jacob Hecksher-Sorensen. | Backbone Marker:R. Armstrong; Backbone Size:5635; Vector Backbone:pIRESRed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:17:54 | 2 | |
|
pEF1a-mRor2deltaIg Resource Report Resource Website |
RRID:Addgene_22629 | Ror2 delta Ig | Mus musculus | Ampicillin | PMID:19720827 | Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of Ig domain | 2026-08-25 09:17:53 | 0 | |
|
pEF1a-mRor2deltaPro Resource Report Resource Website |
RRID:Addgene_22634 | Ror2 delta Pro | Mus musculus | Ampicillin | PMID:19720827 | Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of Pro domain | 2026-08-25 09:17:53 | 0 | |
|
pAL101 Resource Report Resource Website |
RRID:Addgene_22474 | PIF6APB | Mus musculus | Ampicillin | PMID:19749742 | Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-25 09:17:44 | 0 | ||
|
pEF1a-mRor2deltaKringle Resource Report Resource Website |
RRID:Addgene_22630 | Ror2 delta Kringle | Mus musculus | Ampicillin | PMID:19720827 | Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of Kringle domain | 2026-08-25 09:17:53 | 0 | |
|
pSG5 PPAR alpha Resource Report Resource Website 10+ mentions |
RRID:Addgene_22751 | PPARalpha | Mus musculus | Ampicillin | The PPARa cDNA was isolated from an adipocyte lambda ZAPII cDNA library (Tontonoz et al 1994 Genes Dev 8:1224-1234). | Backbone Marker:Stratagene; Backbone Size:4000; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:01 | 18 | ||
|
pAL113 Resource Report Resource Website |
RRID:Addgene_22471 | PhyB NT | Mus musculus | Ampicillin | PMID:19749742 | Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | Y276H | 2026-08-25 09:17:44 | 0 | |
|
pId1-IRES-YFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_22667 | Inhibitor of DNA binding 1 | Mus musculus | Ampicillin | PMID:19896442 | This plasmid is identical to pId1-IRES-Venus (Plasmid #22663). | Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:17:55 | 1 | |
|
pEGFP-C1-mApg5 Resource Report Resource Website |
RRID:Addgene_22958 | autophagy related genes 5 | Mus musculus | Kanamycin | PMID:11266458 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:18:16 | 0 | ||
|
pCI-neo-mApg5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22956 | autophagy related genes 5 | Mus musculus | Ampicillin | PMID:11266458 | Backbone Marker:Promega; Backbone Size:5472; Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:15 | 5 | ||
|
Mfn1-Myc Resource Report Resource Website 10+ mentions |
RRID:Addgene_23212 | Mfn1 | Mus musculus | Ampicillin | PMID:12527753 | Backbone Size:5000; Vector Backbone:pcDNA3.1(-)/Myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:33 | 20 | ||
|
pcDNA-Ikka-HA WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_23296 | IKK alpha | Mus musculus | Ampicillin | PMID:9710600 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:39 | 2 | ||
|
pcDNA-Ikka-HA (K44M) Resource Report Resource Website 1+ mentions |
RRID:Addgene_23297 | IKK alpha | Mus musculus | Ampicillin | PMID:9710600 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K44M | 2026-08-25 09:18:39 | 2 | |
|
pCMV-Tag2B Flag BimEL(TD) Resource Report Resource Website |
RRID:Addgene_23092 | Bim EL (TD) | Mus musculus | Kanamycin | PMID:18498746 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Changed Threonine 112 to Aspartate | 2026-08-25 09:18:25 | 0 | |
|
pCMV-Tag2B Flag BimEL(TA) Resource Report Resource Website |
RRID:Addgene_23093 | Bim EL (TA) | Mus musculus | Kanamycin | PMID:18498746 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Changed Threonine 112 to Alanine | 2026-08-25 09:18:25 | 0 | |
|
pDUP 4-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_23022 | c-src | Mus musculus | Ampicillin | PMID:9343417 | This clone was assembled from multiple PCR products by using the following primers, described by their sequence relationship to the transcribed DUP RNA. DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33 exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo- gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2 and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6 (TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron 1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA GAA) also contains the ApaI site and is complementary to intron 1 and primer DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon 1. A series of PCRs was performed with the following primers and templates. Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4, 5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the 1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8 PCR products as templates. A final PCR assembled a complete fragment by using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final PCR product was cleaved with NsiI and DraIII and inserted into the CMV DUP33 vector also cleaved with NsiI and DraIII. This clone was designated DUP4-1. | Backbone Marker:Z Dominski and R Kole; Backbone Size:0; Vector Backbone:DUP33; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:18:20 | 1 | |
|
pCMV-Tag2B Flag BimEL Resource Report Resource Website 1+ mentions |
RRID:Addgene_23090 | Bim EL | Mus musculus | Kanamycin | PMID:18498746 | Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:18:25 | 1 | ||
|
pCDNA3 Flag DLC2 Resource Report Resource Website |
RRID:Addgene_24269 | DLC2 | Mus musculus | Ampicillin | PMID:12591950 | Backbone Marker:invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:19:35 | 0 | ||
|
nAChR beta2 WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_24272 | nAChR beta2 WT | Mus musculus | Ampicillin | PMID:14684858 | Backbone Size:5472; Vector Backbone:pCIneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:19:35 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
