Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Oct4A -12 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GTGGGACTGGGGAGGGAGAG
Proper citation: RRID:Addgene_50921 Copy
Species: Homo sapiens
Genetic Insert: Sox17 -91 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GGGCGTGGGCCTAACGACGC
Proper citation: RRID:Addgene_50923 Copy
Species: Homo sapiens
Genetic Insert: Oct4A -158 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GGGGCGCCAGTTGTGTCTCC
Proper citation: RRID:Addgene_50922 Copy
Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24451383
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.
Proper citation: RRID:Addgene_50884 Copy
Vector Backbone Description: Backbone Marker:Nakagawa,T.; Backbone Size:6034; Vector Backbone:pUGW11; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23956122
Comments: Please use the reference links above to access a published protocol for using plasmids pRGE31, pRGEB31, pRGE32 and pRGEB32 as well as a CRISPR design software tool.
Proper citation: RRID:Addgene_50929 Copy
Species: Homo sapiens
Genetic Insert: Sox17 -177 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GCTCCGGCTAGTTTTCCCGG
Proper citation: RRID:Addgene_50925 Copy
Species: synthetic
Genetic Insert: negative control sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: Please note that Addgene's diagnostic digest results suggest that the backbone may be longer than suggested.
Proper citation: RRID:Addgene_50927 Copy
Species: Homo sapiens
Genetic Insert: Sox17-296 sgRNA
Vector Backbone Description: Backbone Size:7145; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24346702
Comments: gRNA target sequence GGGCAAGTACGTCGATTCCA
Proper citation: RRID:Addgene_50926 Copy
Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.
Proper citation: RRID:Addgene_50893 Copy
Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.
Proper citation: RRID:Addgene_50899 Copy
Species: Homo sapiens
Genetic Insert: SRP14 and SRP9
Vector Backbone Description: Backbone Marker:Chang-Deng Hu (Addgene Plasmid# 22010); Backbone Size:5216; Vector Backbone:pBiFC-VN173; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_50932 Copy
Species: Homo sapiens
Genetic Insert: scAluYNF1
Vector Backbone Description: Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25697503
Proper citation: RRID:Addgene_50934 Copy
Species: Homo sapiens
Genetic Insert: AluYNF1
Vector Backbone Description: Backbone Marker:Dewannieux,M., Esnault,C. and Heidmann,T. (2003) LINE-mediated retrotransposition of marked Alu sequences. Nat. Genet., 35, 41-4; Backbone Size:2773; Vector Backbone:pAlu-NeoTet; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25697503
Proper citation: RRID:Addgene_50933 Copy
Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.
Proper citation: RRID:Addgene_50894 Copy
Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.
Proper citation: RRID:Addgene_50897 Copy
Species: Homo sapiens
Genetic Insert: human NKCC1 (synthetic)
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5316; Vector Backbone:pcDNA 3.1 neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid constructed from pcDNA3.1 Flag YFP hNKCC1 WT (NT17). See Addgene plasmid# 49085 (http://www.addgene.org/49085/) for plasmid map of wild-type construct.
Proper citation: RRID:Addgene_50896 Copy
Species: Homo sapiens
Genetic Insert: RanGTPase activating protein 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5677; Vector Backbone:pET11a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22464730
Proper citation: RRID:Addgene_50941 Copy
Genetic Insert: PHAkt
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100
Proper citation: RRID:Addgene_50837 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB 1-908
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909100
Comments: Please note this plasmid is a crucial component of the system described in this additional reference: Toettcher JE, Weiner OD, Lim WA, Cell. 2013 Dec 5;155(6):1422-34. doi: 10.1016/j.cell.2013.11.004. (PMID 24315106)
Proper citation: RRID:Addgene_50839 Copy
Genetic Insert: promoter sacB - gfp
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17692983
Proper citation: RRID:Addgene_48115 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.