Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
RasV12 in pENTR1A (w99-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_22252 | HRAS G12V | Homo sapiens | Kanamycin | Backbone Size:2466; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:10 | 2 | |||
|
pEGFPC1-EPSIN 1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_22228 | Epsin 1 | Rattus norvegicus | Kanamycin | PMID:9723620 | Please note: Addgene's quality control sequence found the EPSIN1 gene has an insertion of threonine after aa 821 and since there is no stop codon, ESPIN1 contains the additional c terminal residues VDGTAGPGSTGSR. The depositor noted that these discrepancies do NOT affect plasmid function. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | please see depositor comment below | 2026-08-15 01:12:09 | 10 |
|
pENTR/pTER shMDC1 (441-1) Resource Report Resource Website |
RRID:Addgene_22192 | sh Mediator of DNA damage checkpoint 1 | Homo sapiens | Kanamycin | Backbone Marker:Invitrogen; Backbone Size:2562; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:09 | 0 | |||
|
TetR in pENTR1A (559-1) Resource Report Resource Website 1+ mentions |
RRID:Addgene_22265 | Tetracycline repressor | Kanamycin | Please note that there are several sequence discrepancies between Addgene's quality control sequence and the depositor's reference sequence. These changes do not affect plasmid function. | Backbone Marker:Invitrogen; Backbone Size:2386; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Yeast Expression, Worm Expression, Insect Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:10 | 2 | |||
|
SV40 Large T K1 mutant in pENTR1A (w414-1) Resource Report Resource Website |
RRID:Addgene_22270 | SV40 Large T antigen TK1 mutant (E107K) | Kanamycin | Large T antigen K1 mutant can no longer bind and inactivate the Rb, p130 and p107 proteins (DeCaprio et al. 1988, Stubdal et al. 1997). It also fails to activate Akt (Yu and Alwine 2008). | Backbone Marker:Invitrogen; Backbone Size:2279; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | E107K (K1 mutation) | 2026-08-15 01:12:10 | 0 | ||
|
SRS-MTBD(19/19), dimer, no myc, ux Resource Report Resource Website |
RRID:Addgene_22388 | Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein | Mus musculus | Kanamycin | Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:11 | 0 | |||
|
SRS-MTBD(22/19)wt, dimer, plus myc tag Resource Report Resource Website |
RRID:Addgene_22392 | Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein | Mus musculus | Kanamycin | Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:11 | 0 | |||
|
pENTR/pTER shATM #2 (730-2) Resource Report Resource Website |
RRID:Addgene_22527 | sh Ataxia telangiectasia mutated | Kanamycin | shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979. | Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:12 | 0 | |||
|
pENTRegfp3 Resource Report Resource Website |
RRID:Addgene_22464 | EGFP | Kanamycin | PMID:17948311 | Egfp ORF was amplified with an attB1 site on the 5’ end and an attB2 site on the 3’ end. ORF is in frame with 3’ entry clone. Egfp ORF missing the termination codon. | Backbone Size:5000; Vector Backbone:pDONR; Vector Types:Entry clone; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:12 | 0 | ||
|
pJA281 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22513 | Pmex-5::mCherry (w introns w/o stop) | Caenorhabditis elegans | Kanamycin | PMID:21637852 | Backbone Marker:Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4P1R; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:12 | 2 | ||
|
pENTRbasEGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_22453 | EGFP | Kanamycin | PMID:17948311 | Backbone Size:3000; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:12 | 4 | |||
|
Fret-Stop-Fret TOPO Resource Report Resource Website 1+ mentions |
RRID:Addgene_22774 | fret-STOP-fret | Kanamycin | PMID:11751630 | Plasmid containing FRT-STOP-FRT cassette for use in expressing genes only after Flp-mediated recombination. It's like the LSL cassette ( http://www.addgene.org/11584 but this one is a FSF cassette | Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:15 | 1 | ||
|
pAdTrack-CMV FLAG Rev-Erb alpha Resource Report Resource Website 1+ mentions |
RRID:Addgene_22745 | Rev Erb alpha | Homo sapiens | Kanamycin | PMID:20018698 | Backbone Marker:Available at Addgene (#16405); Backbone Size:9000; Vector Backbone:pAdTrack-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:15 | 1 | ||
|
pAdTrack shALAS-1 Resource Report Resource Website |
RRID:Addgene_22748 | shALAS-1 | Mus musculus | Kanamycin | PMID:20018698 | targeting sequence: CCAAGATAGTAGCATTTGAAA | Backbone Marker:Available at Addgene (#16404); Backbone Size:8300; Vector Backbone:pAdTrack; Vector Types:Mammalian Expression, Adenoviral, RNAi; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:15 | 0 | |
|
pCR-Myt1NB580 Resource Report Resource Website |
RRID:Addgene_22740 | Myelin Transcription Factor 1 | Mus musculus | Kanamycin | 580bp Myt1 insert can be released with EcoRI. This is the 580bp cDNA probe for Northern blots. Paper is in preparation. Tentatively titled "The Myelin Transcription Factor 1 (Myt1) is Essential for Neural Development" | Backbone Size:3500; Vector Backbone:pCR-Blunt II TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:14 | 0 | ||
|
pBTB-2 Resource Report Resource Website |
RRID:Addgene_22818 | Kanamycin | PMID:16496398 | Addgene's QC sequence shows a 4bp gap with the depositor's provided sequence. The lab does not believe this affects the plasmid activity. | Backbone Size:3740; Vector Backbone:pBTB-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:15 | 0 | |||
|
pBMTL-2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22812 | Kanamycin | PMID:16496398 | Backbone Size:3863; Vector Backbone:pBMTL-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:15 | 1 | ||||
|
pBMT-2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22839 | Kanamycin | PMID:16496398 | Backbone Size:3803; Vector Backbone:pBMT-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:15 | 1 | ||||
|
pBT-2 Resource Report Resource Website |
RRID:Addgene_22833 | Kanamycin | PMID:16496398 | Backbone Size:2558; Vector Backbone:pBT-2; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:12:15 | 0 | ||||
|
pMX234 Resource Report Resource Website 1+ mentions |
RRID:Addgene_23006 | mRFP-CenpB | Cricetulus griseus | Kanamycin | PMID:18267093 | Backbone Size:4004; Vector Backbone:pCMV-M1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | deleted CenpB amino acids 169-606, T145S | 2026-08-15 01:12:17 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
