Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 276 showing 5501 ~ 5520 out of 328,853 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.addgene.org/178273

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178273 Copy   

    • RRID:Addgene_178394

http://www.addgene.org/178394

Species: Kaposi's sarcoma-associated herpesvirus
Genetic Insert: KSHV Downstream Mir-SYN
Vector Backbone Description: Backbone Size:5442; Vector Backbone:pCDNA3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33411764
Comments: Sequences and further information can be found at https://www.med.unc.edu/orfeome/downloads/pome

Proper citation: RRID:Addgene_178394 Copy   

http://www.addgene.org/178274

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178274 Copy   

http://www.addgene.org/178266

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178266 Copy   

http://www.addgene.org/178267

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178267 Copy   

    • RRID:Addgene_178381

http://www.addgene.org/178381

Species: Kaposi's sarcoma-associated herpesvirus
Genetic Insert: KSHV ORF K5
Vector Backbone Description: Backbone Size:7780; Vector Backbone:pDEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33411764
Comments: Sequences and further information can be found at https://www.med.unc.edu/orfeome/downloads/pome

Proper citation: RRID:Addgene_178381 Copy   

    • RRID:Addgene_178382

http://www.addgene.org/178382

Species: Kaposi's sarcoma-associated herpesvirus
Genetic Insert: KSHV ORF K7
Vector Backbone Description: Backbone Size:7780; Vector Backbone:pDEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33411764
Comments: Sequences and further information can be found at https://www.med.unc.edu/orfeome/downloads/pome

Proper citation: RRID:Addgene_178382 Copy   

http://www.addgene.org/178265

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178265 Copy   

http://www.addgene.org/178262

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178262 Copy   

    • RRID:Addgene_178383

http://www.addgene.org/178383

Species: Kaposi's sarcoma-associated herpesvirus
Genetic Insert: KSHV ORF 16
Vector Backbone Description: Backbone Size:11588; Vector Backbone:pVR21; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33411764
Comments: Sequences and further information can be found at https://www.med.unc.edu/orfeome/downloads/pome

Proper citation: RRID:Addgene_178383 Copy   

http://www.addgene.org/178263

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178263 Copy   

    • RRID:Addgene_17827

    This resource has 1+ mentions.

http://www.addgene.org/17827

Species: Discosoma sp., A. victoria
Genetic Insert: E. coli optimized red flourescent protein (RFPec), GFPuv
Vector Backbone Description: Backbone Marker:Groningen Biotechnology Center; Backbone Size:0; Vector Backbone:pBAD24; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16845378

Proper citation: RRID:Addgene_17827 Copy   

http://www.addgene.org/178333

Species: Mus musculus
Genetic Insert: pAAV CAG iGluSnFR3 v857.PDGFR
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pAAV CAG; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767

Proper citation: RRID:Addgene_178333 Copy   

http://www.addgene.org/178337

Species: Mus musculus
Genetic Insert: pAAV GFAP iGluSnFR3 v857.SGZ
Vector Backbone Description: Backbone Size:4852; Vector Backbone:pAAV GFAP; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767

Proper citation: RRID:Addgene_178337 Copy   

    • RRID:Addgene_178330

    This resource has 1+ mentions.

http://www.addgene.org/178330

Species: Mus musculus
Genetic Insert: pAAV hSyn iGluSnFR3 v857.SGZ
Vector Backbone Description: Backbone Size:4200; Vector Backbone:pAAV hSyn; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37142767

Proper citation: RRID:Addgene_178330 Copy   

http://www.addgene.org/178280

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178280 Copy   

http://www.addgene.org/178281

Species: Homo sapiens
Genetic Insert: nPC Tagged mCherry-NLS
Vector Backbone Description: Backbone Size:9000; Vector Backbone:pLKO; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35290801
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.07.13.451021v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_178281 Copy   

http://www.addgene.org/178284

Species: Chlorocebus sabaeus (African green monkey)
Genetic Insert: 83,963 targeting sgRNAs, 1,000 non-targeting sgRNAs
Vector Backbone Description: Backbone Marker:Addgene (#96925); Vector Backbone:pXPR_050; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33147444
Comments: The backbone does not contain Cas9. Use with Cas9-expressing plasmid: pLX_311-Cas9 (Addgene #96924).

Proper citation: RRID:Addgene_178284 Copy   

    • RRID:Addgene_17853

http://www.addgene.org/17853

Species: Homo sapiens
Genetic Insert: shDusp5
Vector Backbone Description: Backbone Marker:Chen lab; Backbone Size:8200; Vector Backbone:MDH1-404-H2Kb2; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17382377
Comments: Target region of DUSP5: CAAGGGGAGGCAGCCAGCTCCACGTTTAT (XM_140740: 1197-1225, CDS).

Proper citation: RRID:Addgene_17853 Copy   

    • RRID:Addgene_17854

    This resource has 1+ mentions.

http://www.addgene.org/17854

Species: Homo sapiens
Genetic Insert: shSHP2
Vector Backbone Description: Backbone Marker:Chen lab; Backbone Size:8200; Vector Backbone:MDH1-404-H2Kb2; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17382377
Comments: Target region of SHP-2: TTGCCCACGCATATCATGTAGT (NM_011202.3: 5421 to 5442, 3’ UTR).

Proper citation: RRID:Addgene_17854 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch