Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: kozak consensus - N-CretrcintG
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26258682
Proper citation: RRID:Addgene_69572 Copy
Species: E. coli
Genetic Insert: aac
Vector Backbone Description: Backbone Size:2140; Vector Backbone:pSG5; Vector Types:; Bacterial Resistance:Apramycin
Defining Citation: PMID:30191290
Proper citation: RRID:Addgene_69615 Copy
Species: Transposon Tn5
Genetic Insert: aphII
Vector Backbone Description: Backbone Size:2140; Vector Backbone:pSG5; Vector Types:Bacterial Expression, Streptomyces- E. coli shuttle vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16776656
Comments: Stable replicating, multi copy shuttle vector for thiostrepton induced gene expression in Streptomyces
temperature sensitive replication (G. Muth, B. Nußbaumer, W. Wohlleben and A. Pühler (1989) A vector system with temperature-sensitive replication for gene disruption and mutational cloning in streptomycetes. Mol. Gen. Genet. 219, 341-348 )
http://www.uni-tuebingen.de/en/faculties/faculty-of-science/departments/inter-faculty-institutes-and-centres/imit/units/mikrobiologiebiotechnologie/work-groups/muth/plasmids.html
Proper citation: RRID:Addgene_69614 Copy
Species: Homo sapiens
Genetic Insert: L1PA13A
Vector Backbone Description: Backbone Size:3530; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The ORF1 and ORF2 of the codon optimized L1PA13A element were commercially synthetically generated and then cloned into the parental pBS-L1PA1CHmneo by swapping the two ORFs.
Proper citation: RRID:Addgene_69613 Copy
Species: Homo sapiens
Genetic Insert: p53
Vector Backbone Description: Backbone Size:7429; Vector Backbone:pRRL; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24006363
Comments: The silent mutations prevent targeting by shRNA p53 published in Brummelkamp et al Science. 2002;296:550–3.
Proper citation: RRID:Addgene_69579 Copy
Species: Homo sapiens
Genetic Insert: L1PA1
Vector Backbone Description: Backbone Size:3530; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: The blast rescue cassette was commercially synthesized and cloned into the EcoRI-NotI sites of L1PA1CHmneo to swap the mneo cassette with the blast rescue cassette sequence
Proper citation: RRID:Addgene_69611 Copy
Species: Synthetic
Genetic Insert: Gbeta-2A-cpV-Ggamma2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:Clontech-style N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26799488
Proper citation: RRID:Addgene_69625 Copy
Genetic Insert: Snap-Omp25
Vector Backbone Description: Backbone Marker:Jason Moffat; Vector Backbone:pLJM2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25837514
Proper citation: RRID:Addgene_69599 Copy
Species: Rattus norvegicus
Genetic Insert: paGFP-Omp25
Vector Backbone Description: Backbone Marker:Jason Moffat; Backbone Size:7327; Vector Backbone:pLJM2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25837514
Proper citation: RRID:Addgene_69598 Copy
Vector Backbone Description: Vector Backbone:GGdest; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26352799
Proper citation: RRID:Addgene_69538 Copy
Species: Synthetic
Genetic Insert: Histone 2B - green fluorescent protein fusion
Vector Backbone Description: Backbone Marker:David Baltimore; Vector Backbone:FUGW; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_69550 Copy
Species: Homo sapiens
Genetic Insert: CYP2C9
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCW; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Modification of CYP2C9 for bacterial expression as per Barnes et al. PNAS 88:5597, 1991 [PMID: 1829523]: First 8 amino acids of CYP2C cDNAs replaced with those of bovine 17α hydroxylase (MALLLAVF) to optimize bacterial expression.
Proper citation: RRID:Addgene_69554 Copy
Species: Homo sapiens
Genetic Insert: L1PA8
Vector Backbone Description: Backbone Size:3530; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22918960
Comments: The ORF1 and ORF2 of the L1PA8 element were commercially synthetically generated and then cloned into the parental pBS-L1PA1CHmneo by swapping the two ORFs.
Proper citation: RRID:Addgene_69608 Copy
Species: Homo sapiens
Genetic Insert: CYP2C8
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCW; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Modification of CYP2C8 for bacterial expression as per Barnes et al. PNAS 88:5597, 1991 [PMID: 1829523]: First 8 amino acids of CYP2C cDNAs replaced with those of bovine 17α hydroxylase (MALLLAVF) to optimize bacterial expression. An XbaI site was placed after the stop codon The insert was ligated into NdeI and XBbaI cut pCW ori+.
Proper citation: RRID:Addgene_69604 Copy
Species: Mus musculus
Genetic Insert: Runx1 +23 intronic enhancer
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4777; Vector Backbone:pENTR attL4-R1; Vector Types:5' Gateway Entry Vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25594182
Comments: All PCR was performed using the High Fidelity Advantage 2 PCR Kit (Clontech). The Runx1 +23 enhancer (1) was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (XhoI and BamHI sites added) 5’-GGCTCGAGGGATCCGGGGTGGGAGGTGTAAGTTC-3’ and Reverse (BglII and NotI sites added) 5’- GGGCGGCCGCAGATCTCAGGTGTCAGCAACCCATC -3’. The PCR fragment was gel purified, XhoI/BglII digested, ligated into XhoI/BamHI digested Tol2kit (2) #228 p5E-MCS vector and sequence verified. The mouse beta-globin minimal promoter was PCR amplified from C57/BL6 mouse genomic DNA using the following primers: Forward (SpeI site added) 5’-GGACTAGTCCAATCTGCTCAGAGAGGACA-3’ and Reverse (SacII site added) 5’-GGCCGCGGGATGTCTGTTTCTGAGGTTGC-3’. The beta-globin minimal promoter and Runx1+23 5’ entry vector were SpeI/SacII digested and ligated together. Multisite Gateway reactions were performed according to the Invitrogen protocol.
1. Nottingham, W. T., Jarratt, A., Burgess, M., Speck, C. L., Cheng, J.-F., Prabhakar, S., et al. (2007). Runx1-mediated hematopoietic stem-cell emergence is controlled by a Gata/Ets/SCL-regulated enhancer. Blood, 110(13), 4188–4197. http://doi.org/10.1182/blood-2007-07-100883
2. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., et al. (2007). The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics : an Official Publication of the American Association of Anatomists, 236(11), 3088–3099. http://doi.org/10.1002/dvdy.21343
Proper citation: RRID:Addgene_69602 Copy
Species: Homo sapiens
Genetic Insert: Centrin 3
Vector Backbone Description: Backbone Marker:Arshad Desai (Addgene plasmid# 44432); Vector Backbone:pIC242; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_69746 Copy
Species: Homo sapiens
Genetic Insert: Centrin 1
Vector Backbone Description: Backbone Marker:Arshad Desai (Addgene plasmid# 44432); Vector Backbone:pIC242; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_69744 Copy
Species: Homo sapiens
Genetic Insert: spc24
Vector Backbone Description: Backbone Marker:Arshad Desai (Addgene plasmid# 44432); Vector Backbone:pIC242; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_69752 Copy
Species: Other
Genetic Insert: dnaQ926 dam seqA emrR ugi CDA1
Vector Backbone Description: Backbone Marker:David Liu Lab; Backbone Size:2992; Vector Backbone:CloDF13; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:26443021
Comments: The authors strongly recommend that all MP-carrying strains be maintained in rich media supplemented by 25 mM glucose. The expression of the MP-borne mutators is regulated by the E. coli arabinose pBAD promoter, which is efficiently repressed at high concentrations of glucose. Please consult Badran and Liu, Nature Communications (2015) for more detailed strain maintenance protocols.
Proper citation: RRID:Addgene_69669 Copy
Species: Homo sapiens
Genetic Insert: Apoptosis signal-regulating kinase 3
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_69728 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
