Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: N meningitidis
Genetic Insert: NmCas9
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23940360
Proper citation: RRID:Addgene_47872 Copy
Genetic Insert: TALE-mClover
Vector Backbone Description: Vector Backbone:pTALYM3; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363
Proper citation: RRID:Addgene_47878 Copy
Species: Homo sapiens
Genetic Insert: hCas9 with C. elegans 5' and 3' UTRs
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:Bluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979577
Proper citation: RRID:Addgene_47911 Copy
Genetic Insert: TALE-mRuby2
Vector Backbone Description: Vector Backbone:pTALYM4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363
Proper citation: RRID:Addgene_47879 Copy
Vector Backbone Description: Vector Backbone:pCAG-T7-TALEN (Sangamo); Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363
Proper citation: RRID:Addgene_47876 Copy
Genetic Insert: TALE-Ty1
Vector Backbone Description: Vector Backbone:pTALYM9; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24096363
Proper citation: RRID:Addgene_47877 Copy
Species: N meningitidis
Genetic Insert: NmCas9
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23940360
Proper citation: RRID:Addgene_47869 Copy
Species: Homo sapiens
Genetic Insert: human LIN28A
Vector Backbone Description: Backbone Marker:Dr.Toshio Kitamura of the University of Tokyo; Backbone Size:4800; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23812749
Comments: pMXs is from Dr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science. If you use this plasmid in a paper, please cite: Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Exp Hematol. 2003 Nov;31(11):1007-14. Kitamura T, Koshino Y, Shibata F, Oki T, Nakajima H, Nosaka T, Kumagai H.
Proper citation: RRID:Addgene_47902 Copy
Species: Rhodopseudomonas palustris
Genetic Insert: Infrared fluorescent protein
Vector Backbone Description: Backbone Marker:Karl Deisseroth; Vector Backbone:pAAV CaMKII hChR2-EYFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28380331
Proper citation: RRID:Addgene_47903 Copy
Species: Rhodopseudomonas palustris
Genetic Insert: Infrared fluorescent protein
Vector Backbone Description: Backbone Marker:NIDA OTTC; Vector Backbone:pAAV c-fos eYFP; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28380331
Comments: Note that the "N" in the depositor's sequences is legitimately ambiguous in both the Addgene stock and the depositor's original stock. This repeat region may vary in different preps of the plasmid, but it should not affect the plasmid function.
Proper citation: RRID:Addgene_47906 Copy
Species: HPV
Genetic Insert: HPV 11E6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:pNCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_47863 Copy
Species: HPV
Genetic Insert: HPV 6bE6
Vector Backbone Description: Backbone Size:6550; Vector Backbone:pNCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_47862 Copy
Species: N meningitidis
Genetic Insert: NmCas9
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23940360
Proper citation: RRID:Addgene_47867 Copy
Species: Homo sapiens
Genetic Insert: Miro2 E208K/E328K
Vector Backbone Description: Backbone Marker:Dr. Alan Hall, MRC-LMCB; Vector Backbone:pRK5-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16630562
Proper citation: RRID:Addgene_47900 Copy
Species: N meningitidis
Genetic Insert: NmCas9
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pSimpleII; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23940360
Proper citation: RRID:Addgene_47868 Copy
Species: HPV
Genetic Insert: HPV 18 E6no*
Vector Backbone Description: Backbone Size:6550; Vector Backbone:pNCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Comments: **The V44A mutation prevents the internal splicing of the DNA so only the "no *" (unspliced form) of 18E6 is produced.
Proper citation: RRID:Addgene_47866 Copy
Species: Synthetic
Genetic Insert: his_T_min_linker_crp_T_min double terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB777; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 99% (97% and 73% alone, respectively).
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47860 Copy
Species: Synthetic
Genetic Insert: M13_central_T_linker_rrnD_T1 double terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB775; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 100% (97% and 99% alone, respectively).
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47858 Copy
Species: Synthetic
Genetic Insert: ilvGEDA
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB768; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 99%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47851 Copy
Species: Synthetic
Genetic Insert: BBa_B1006 U10
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB774; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 99%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47857 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
