Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: idi2.001.227
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2PNY. http://www.thesgc.org/structures/2PNY/ .
Proper citation: RRID:Addgene_25140 Copy
Species: Xanthomonas
Genetic Insert: Monomer-NK
Vector Backbone Description: Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_31178 Copy
Species: Homo sapiens
Genetic Insert: Mesothelin
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21505261
Comments: Msln Promoter sequence provided by author (see above link)
Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid.
Msln-1F: TCATTTGTTCCCTTTGACGGC
Msln-1R: CTCTCCCCAGCATCCACATTC
Expect 987 nt product
Msln-2F: TTGCCTACAACACCCTGCTGCG
Msln-2R: GCTCACAATGCTTCCATCAAACG
Expect 792 nt product
Proper citation: RRID:Addgene_31305 Copy
Genetic Insert: rtTA-IRES-BirA
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20890903
Proper citation: RRID:Addgene_31375 Copy
Species: Oryctolagus cuniculus
Genetic Insert: solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17895247
Comments: pEGF-RN1.seq
Make by SS's lab
Randy HAll's HA-RN1 cut with ECOR1 & XHO1
pEGFP-C2.seq cut with ECOR1 & SAL1
ligated.
eGFP translation starts @ 613 rN1@ 1375
Proper citation: RRID:Addgene_31636 Copy
Species: Mus musculus
Genetic Insert: NLS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20212155
Proper citation: RRID:Addgene_31871 Copy
Species: Rhodopseudomonas palustris
Genetic Insert: iRFP
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:7384; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21765402
Comments: For additional protocols on using iRFP in other tissue types please review:
Verkhusha. Deep-tissue photoacoustic tomography of a genetically encoded near-infrared fluorescent probe. Angewandte Chemie Int. Ed. 2012, 51: 1448-1451.
PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22213541/
For more information on in vivo imaging, please see:
https://www.addgene.org/fluorescent_proteins/in_vivo/
Proper citation: RRID:Addgene_31856 Copy
Species: Mus musculus
Genetic Insert: Akt1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21147110
Proper citation: RRID:Addgene_31790 Copy
Species: Homo sapiens
Genetic Insert: human STAG2 cDNA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4727; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21852505
Proper citation: RRID:Addgene_31976 Copy
Species: Homo sapiens
Genetic Insert: MPP8
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3R93. http://www.thesgc.org/structures/3R93/
Proper citation: RRID:Addgene_32050 Copy
Species: Homo sapiens
Genetic Insert: CXXC1
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3QMB/
http://www.thesgc.org/structures/3QMC/
http://www.thesgc.org/structures/3QMD/
http://www.thesgc.org/structures/3QMG/
http://www.thesgc.org/structures/3QMH/
http://www.thesgc.org/structures/3QMI/
Proper citation: RRID:Addgene_32045 Copy
Species: Homo sapiens
Genetic Insert: GMIP
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3QWE. http://www.thesgc.org/structures/3QWE/
Proper citation: RRID:Addgene_32046 Copy
Species: Homo sapiens
Genetic Insert: TBC1D7
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3QWL. http://www.thesgc.org/structures/3QWL/
Proper citation: RRID:Addgene_32047 Copy
Genetic Insert: PREX1
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3QIK. http://www.thesgc.org/structures/3QIK/
Proper citation: RRID:Addgene_32041 Copy
Species: K. polysporus
Genetic Insert: DCR1(15-355)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21784247
Comments: The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora
Proper citation: RRID:Addgene_32035 Copy
Species: K. polysporus
Genetic Insert: DCR1(15-355)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21784247
Comments: The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora
Proper citation: RRID:Addgene_32032 Copy
Species: Homo sapiens
Genetic Insert: PHF20
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3QII. http://www.thesgc.org/structures/3QII/
Proper citation: RRID:Addgene_32039 Copy
Species: K. polysporus
Genetic Insert: DCR1(1-384)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21784247
Comments: The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora
Proper citation: RRID:Addgene_32031 Copy
Species: K. polysporus
Genetic Insert: DCR1(15-355)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21784247
Comments: The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora
Proper citation: RRID:Addgene_32023 Copy
Species: K. polysporus
Genetic Insert: DCR1(15-355)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21784247
Comments: The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora
Proper citation: RRID:Addgene_32025 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
