Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: A3A-nSpCas9(D10A)-UGI
Vector Backbone Description: Backbone Marker:Caixia Gao, Addgene Plasmid #98164; Vector Backbone:pnCas9-PBE; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39928528
Proper citation: RRID:Addgene_238019 Copy
Species: Other
Genetic Insert: Fas
Vector Backbone Description: Vector Backbone:PAAV-Syn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40540394
Proper citation: RRID:Addgene_242230 Copy
Species: Other
Genetic Insert: Fas
Vector Backbone Description: Vector Backbone:PAAV-Syn; Vector Types:Mammalian Expression, AAV, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40540394
Proper citation: RRID:Addgene_242233 Copy
Species: Other
Genetic Insert: puromycin resistance cassette liked to a random 10N barcode
Vector Backbone Description: Backbone Marker:Jonathan Weissman; Vector Backbone:n.a.; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40705858
Proper citation: RRID:Addgene_238546 Copy
Species: Other
Genetic Insert: 8xHis-tag is attached to the N-terminus of rnhA (RNase HI) Kanamycin resistant gene is inserted upstream of rnhA
Vector Backbone Description: Vector Backbone:this is a strain; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37159417
Comments: Primers: (1)CACCAATCTCAATGATCTTGTGG, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)GCGTCCGCGATAGCGTAAA. Expected product size: 666 bp with primer (1) and (2), 1042 bp with primer (3) and (4).
Guzit is a RNase HI(rnhA) His-tagged E. coli strain made for a cell-free expression system.
His-tagged RNase HI expressed from the rnhA gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnhA using the λ-Red recombination system.
Precuorsor strain is Rosseta 2.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196902 Copy
Species: Other
Genetic Insert: "8xHis-tag is attached to the N-terminus of rnc (RNase III) Kanamycin resistant gene is inserted upstream of rnc"
Vector Backbone Description: Vector Backbone:this is a strain; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:37159417
Comments: Primers: (1)AACGGCTATCTGGATGAGC, (2)CAGTCATAGCCGAATAGCCT, (3)CGGTGCCCTGAATGAACTGC, (4)CGATGAGTTAATGCCTGCTGCA. Expected product size: 842 bp with primer (1) and (2), 1038 bp with primer (3) and (4).
RNase III-His is an E. coli strain made for a cell-free expression system.
His-tagged RNase III expressed from the rnc gene can be removed using Ni-NTA resin upon the preparation of cell-free extract. A kanamycin resistant gene was inserted upstream of rnc using the λ-Red recombination system.
Precuorsor strain is Rosseta 2.
Please visit https://www.biorxiv.org/content/10.1101/2022.07.28.501919v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_196903 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230945 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230944 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230949 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230947 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230946 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230940 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230962 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230961 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230956 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230955 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230953 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230959 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230958 Copy
Species: Other
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pdCas9; Vector Types:CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39811663
Proper citation: RRID:Addgene_230957 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
