Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:kanamycin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

33,912 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
IDI2
 
Resource Report
Resource Website 		RRID:Addgene_25140 idi2.001.227 Homo sapiens Kanamycin PDB: 2PNY. http://www.thesgc.org/structures/2PNY/ . Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:12:37 0
Monomer NK
 
Resource Report
Resource Website 		RRID:Addgene_31178 Monomer-NK Xanthomonas Kanamycin Backbone Size:2672; Vector Backbone:pJ201; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:32 0
pAdEasy-Msln-iCre-HA-Flag
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31305 Mesothelin Homo sapiens Kanamycin PMID:21505261 Msln Promoter sequence provided by author (see above link) Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid. Msln-1F: TCATTTGTTCCCTTTGACGGC Msln-1R: CTCTCCCCAGCATCCACATTC Expect 987 nt product Msln-2F: TTGCCTACAACACCCTGCTGCG Msln-2R: GCTCACAATGCTTCCATCAAACG Expect 792 nt product Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin 2026-08-15 01:13:30 2
pAd:CMV-rtTA-IRES-birA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31375 rtTA-IRES-BirA Kanamycin PMID:20890903 Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin 2026-08-15 01:13:35 1
pEGFP-rbNHERF1
 
Resource Report
Resource Website 		RRID:Addgene_31636 solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 Oryctolagus cuniculus Kanamycin PMID:17895247 pEGF-RN1.seq Make by SS's lab Randy HAll's HA-RN1 cut with ECOR1 & XHO1 pEGFP-C2.seq cut with ECOR1 & SAL1 ligated. eGFP translation starts @ 613 rN1@ 1375 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:35 0
pNLS-LSSmKate2-N1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31871 NLS Mus musculus Kanamycin PMID:20212155 Backbone Marker:Clontech; Backbone Size:4678; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin K69Y/P131T/S148G/M167D/T183S/M196V compared to mKate but numbering is relative to EGFP. 2026-08-15 01:13:36 1
pShuttle-CMV-iRFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31856 iRFP Rhodopseudomonas palustris Kanamycin PMID:21765402 For additional protocols on using iRFP in other tissue types please review: Verkhusha. Deep-tissue photoacoustic tomography of a genetically encoded near-infrared fluorescent probe. Angewandte Chemie Int. Ed. 2012, 51: 1448-1451. PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22213541/ For more information on in vivo imaging, please see: https://www.addgene.org/fluorescent_proteins/in_vivo/ Backbone Marker:Stratagene; Backbone Size:7384; Vector Backbone:pShuttle-CMV; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Kanamycin T2A, S13L, A92T, V104I, V114I, E161K, Y193K, F198Y, D202T, I203V, Y258F, A283V, K288T and N290Y relative to RpBphP2 2026-08-15 01:13:36 8
pENTR-myr-AKT-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31790 Akt1 Mus musculus Kanamycin PMID:21147110 Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-15 01:13:35 1
pEGFP-STAG2-S653Stop
 
Resource Report
Resource Website 		RRID:Addgene_31976 human STAG2 cDNA Homo sapiens Kanamycin PMID:21852505 Backbone Marker:Clontech; Backbone Size:4727; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin changed Serine 653 to Stop codon 2026-08-15 01:13:41 0
MPP8 (3R93)
 
Resource Report
Resource Website 		RRID:Addgene_32050 MPP8 Homo sapiens Kanamycin PDB: 3R93. http://www.thesgc.org/structures/3R93/ Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:38 0
CXXC1
 
Resource Report
Resource Website 		RRID:Addgene_32045 CXXC1 Homo sapiens Kanamycin http://www.thesgc.org/structures/3QMB/ http://www.thesgc.org/structures/3QMC/ http://www.thesgc.org/structures/3QMD/ http://www.thesgc.org/structures/3QMG/ http://www.thesgc.org/structures/3QMH/ http://www.thesgc.org/structures/3QMI/ Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin CXXC domain (amino acids residues 161-222) 2026-08-15 01:13:42 0
GMIP
 
Resource Report
Resource Website 		RRID:Addgene_32046 GMIP Homo sapiens Kanamycin PDB: 3QWE. http://www.thesgc.org/structures/3QWE/ Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin amino acids 80-357 only 2026-08-15 01:13:38 0
TBC1D7
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_32047 TBC1D7 Homo sapiens Kanamycin PDB: 3QWL. http://www.thesgc.org/structures/3QWL/ Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:38 2
PREX1
 
Resource Report
Resource Website 		RRID:Addgene_32041 PREX1 Kanamycin PDB: 3QIK. http://www.thesgc.org/structures/3QIK/ Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin first PDZ domain only (amino acids Residues 607-706) 2026-08-15 01:13:42 0
pRSF-KpDcr1deltaC(E224Q, GiVL-2)
 
Resource Report
Resource Website 		RRID:Addgene_32035 DCR1(15-355) K. polysporus Kanamycin PMID:21784247 The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin E224Q and N195-M215 replaced by P697-D714 of GiDicer 2026-08-15 01:13:42 0
pRSF-KpDcr1deltaC(GiVL-1)
 
Resource Report
Resource Website 		RRID:Addgene_32032 DCR1(15-355) K. polysporus Kanamycin PMID:21784247 The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin H123-N143 replaced by P642-Y645 of GiDicer 2026-08-15 01:13:42 0
PHF20 (3QII)
 
Resource Report
Resource Website 		RRID:Addgene_32039 PHF20 Homo sapiens Kanamycin PDB: 3QII. http://www.thesgc.org/structures/3QII/ Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Tudor domain 2 only (amino acids 83-150) 2026-08-15 01:13:38 0
pRSF-KpDcr1(1-384)
 
Resource Report
Resource Website 		RRID:Addgene_32031 DCR1(1-384) K. polysporus Kanamycin PMID:21784247 The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:38 0
pRSF-KpDcr1deltaC
 
Resource Report
Resource Website 		RRID:Addgene_32023 DCR1(15-355) K. polysporus Kanamycin PMID:21784247 The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:13:42 0
pRSF-KpDcr1deltaC(N184A)
 
Resource Report
Resource Website 		RRID:Addgene_32025 DCR1(15-355) K. polysporus Kanamycin PMID:21784247 The species of DCR1 is Kluyveromyces polysporus, which is also known as Vanderwaltozyma polyspora Backbone Marker:Novagen; Backbone Size:4100; Vector Backbone:sumo-pRSFduet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin N184A 2026-08-15 01:13:38 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch