Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: tdTomato
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex-Neo; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616
Comments: Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004;22:1567–1572
Vazquez MP, Levin MJ (1999) Functional analysis of the intergenic regions of TcP2beta gene loci allowed the construction of an improved Trypanosoma cruzi expression vector. Gene 239: 217–225. doi: 10.1016/S0378-1119(99)00386-8.
Proper citation: RRID:Addgene_47975 Copy
Species: Synthetic
Genetic Insert: tetAC terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB772; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 50%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47855 Copy
Species: Synthetic
Genetic Insert: lambda tR2 terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB766; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 91%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47849 Copy
Species: Synthetic
Genetic Insert: T7 early terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB764; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 96%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47847 Copy
Species: Synthetic
Genetic Insert: T3 early terminator
Vector Backbone Description: Backbone Size:3967; Vector Backbone:pFAB765; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: Terminator efficiency measured at 94%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
Proper citation: RRID:Addgene_47848 Copy
Species: Drosophila melanogaster
Genetic Insert: Bendless
Vector Backbone Description: Backbone Size:5000; Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19141674
Proper citation: RRID:Addgene_47966 Copy
Species: Synthetic
Genetic Insert: promoter 13 and BCD1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23474465
Comments: http://biofab.org/services
RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 48.98
Proper citation: RRID:Addgene_47844 Copy
Species: Homo sapiens
Genetic Insert: Asunder
Vector Backbone Description: Backbone Size:5000; Vector Backbone:CS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23904267
Proper citation: RRID:Addgene_47955 Copy
Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:7780; Vector Backbone:pDEST-47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848
Proper citation: RRID:Addgene_48080 Copy
Species: Homo sapiens
Genetic Insert: Luciferase
Vector Backbone Description: Vector Backbone:pUAS-luc2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848
Proper citation: RRID:Addgene_48081 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:8482; Vector Backbone:two ori derived from pUC19 and pPZP201; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21364738
Comments: level 2 vector for cloning directly from level 0
Proper citation: RRID:Addgene_48076 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4302; Vector Backbone:Backbone with three ori derived from pUC19, p15a from pACYC184 and RK2 from pBIN19; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21364738
Comments: High copy before cloning, medium copy after cloning
Proper citation: RRID:Addgene_48074 Copy
Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:7780; Vector Backbone:pDEST-47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848
Proper citation: RRID:Addgene_48079 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 dummy fragment
Proper citation: RRID:Addgene_48070 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:3142; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: Level P end linker
Proper citation: RRID:Addgene_48064 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 dummy fragment
Proper citation: RRID:Addgene_48065 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:3142; Vector Backbone:pUC19-derived; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: Level P end linker
Proper citation: RRID:Addgene_48062 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 dummy fragment
Proper citation: RRID:Addgene_48068 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 dummy fragment
Proper citation: RRID:Addgene_48069 Copy
Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 dummy fragment
Proper citation: RRID:Addgene_48066 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.