Plasmids   Select Another Resource Report Type

http://www.addgene.org/41141

Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_41141 Copy   

•   Source: Addgene

http://www.addgene.org/41019

Species: Mus musculus
Genetic Insert: RPE65
Vector Backbone Description: Backbone Marker:Connie Cepko (Addgene plasmid #11159); Backbone Size:6135; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid expresses EGFP as a reporter gene from IRES as part of the bicistronic transcript

Proper citation: RRID:Addgene_41019 Copy   

•   Source: Addgene

http://www.addgene.org/41139

Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:ptriex2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_41139 Copy   

•   Source: Addgene

http://www.addgene.org/41093

Species: Drosophila melanogaster
Genetic Insert: Loquacious-PA
Vector Backbone Description: Backbone Marker:Takara; Backbone Size:6000; Vector Backbone:pcold1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653

Proper citation: RRID:Addgene_41093 Copy   

•   Source: Addgene

http://www.addgene.org/41015

Species: Chlamydomonas reinhardtii
Genetic Insert: Channelrhodopsin-2
Vector Backbone Description: Backbone Size:4971; Vector Backbone:pAAV (Adeno-associated Virus); Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_41015 Copy   

•   Source: Addgene

http://www.addgene.org/41096

Species: Homo sapiens
Genetic Insert: TRBP
Vector Backbone Description: Backbone Marker:Takara; Backbone Size:6000; Vector Backbone:pcold1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23063653

Proper citation: RRID:Addgene_41096 Copy   

•   Source: Addgene

http://www.addgene.org/41126

Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:ptriex2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_41126 Copy   

•   Source: Addgene

http://www.addgene.org/41086

Species: Mus musculus
Genetic Insert: smoothened homolog
Vector Backbone Description: Backbone Size:4078; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22981989

Proper citation: RRID:Addgene_41086 Copy   

•   Source: Addgene

http://www.addgene.org/41117

Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:ptriex2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21856427

Proper citation: RRID:Addgene_41117 Copy   

•   Source: Addgene

http://www.addgene.org/41115

Vector Backbone Description: Backbone Marker:Merck; Vector Backbone:ptriex2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21856427
Comments: There is a minor gap between depositor's reference sequence and Addgene's quality control sequence. The gap does not affect SUMO ORF.

Proper citation: RRID:Addgene_41115 Copy   

•   Source: Addgene

http://www.addgene.org/41065

Vector Backbone Description: Backbone Size:4146; Vector Backbone:pTKIP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:20047970

Proper citation: RRID:Addgene_41065 Copy   

•   Source: Addgene

http://www.addgene.org/41209

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-bsx-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TATCTCTGGATCTCGAAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41209 Copy   

•   Source: Addgene

http://www.addgene.org/41161

Species: Homo sapiens
Genetic Insert: PBD HK-AA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/3x myc-C; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16267267
Comments: Addgene plasmid #41162: Plk1-PBDWT (aa 326–603) was cloned in-frame by PCR into a pcDNA3.1 vector encoding an amino-terminal 3xmyc-tag (Invitrogen, Carlsbad, CA) using primers 5
'-CCG GAA TTC CAG ATC TTC GAT TGC TCC CAG CAG CCT GG-3
' and 5
'-CCG CTC GAG TTA GGA GGC CTT GAG ACG GTT GC-3
'. The Plk1-PBDAA mutant (H538A, K540A) was made by site-directed mutagenesis using the following primers: 5'
-CAA TTC TCC GGA GCC CCG CCT ATC TGT CCC-3
' and 5
'-GGG ACA GAT AGG CGG GGC TCC GGA GAA TTG-3
'.

Proper citation: RRID:Addgene_41161 Copy   

•   Source: Addgene

http://www.addgene.org/41160

Species: Homo sapiens
Genetic Insert: Plk1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5527; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7962193
Comments: cDNA fragments spanning parts of the catalytic domains of human protein kinases were amplified by PCR, as described by Schultz and Nigg (1993). A 144 bp fragment (named HsPK28) showing 88% nucleotide identity to Drosophila polo was used to probe a λgt 10 library prepared from a human nasopharyngeal carcinoma (Hitt et al., 1989). Approximately 500,000 plaques were screened by plaque hybridization (Sambrook et al., 1989), and 17 phage showing strong hybridization were purified. DNA was prepared using Lambdasorb (Promega Biotech, Madison, WI). One plasmid (referred to as Plk1-pGEM) with a 2143 bp insert contained the entire coding sequence for a protein kinase closely related to Drosophila polo. This insert was sequenced on both strands by the method of Chen and Seeburg (1985), using the Sequenase kit (United States Biochemicals). To express a full-length Plk1 protein, the 1998 bp fragment of Plk1-pGEM was introduced into the pRc/CMV vector (Invitrogen Corporation, San Diego), to create Plk1-CMV. An N-terminally myc-tagged Plk1-CMV was also constructed. In the resulting mycplk1 protein, the N terminus of Plk1 is extended by the oligopeptide MEQKLISEEDLNMNSCSPGS (Evan et al., 1985).

Proper citation: RRID:Addgene_41160 Copy   

•   Source: Addgene

http://www.addgene.org/41166

Species: Homo sapiens
Genetic Insert: Rootletin
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16203858
Comments: The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing.

Proper citation: RRID:Addgene_41166 Copy   

•   Source: Addgene

http://www.addgene.org/41163

Species: Homo sapiens
Genetic Insert: PICH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17218258
Comments: The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning.

Proper citation: RRID:Addgene_41163 Copy   

•   Source: Addgene

http://www.addgene.org/41152

Species: Homo sapiens
Genetic Insert: Cep215
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4110; Vector Backbone:pCJW206 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18042621
Comments: The Cep215 cDNA sequence was obtained from KIAA1633 clone (from Kazusa DNA Research Institute). Using PCR, a frameshift within the sequence was corrected and missing 5' coding information was obtained by PCR amplification from Marathon cDNA library (Clontech). Constructs were fused to yield the complete coding sequence of Cep215, and subcloned into a mammalian expression vector providing a Myc epitope-tag. All constructs were confirmed by sequencing.

Proper citation: RRID:Addgene_41152 Copy   

•   Source: Addgene

http://www.addgene.org/41151

Species: Homo sapiens
Genetic Insert: Cep170
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pEGFP-T7/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15616186
Comments: The KIAA0470 cDNA was obtained from the Kazusa DNA Research Institute. It was subcloned into pT7-EGFP-C1 (modified from pEGFP-C1; BD Biosciences Clontech), after removing the ATG. Specifically, a 5kb SalI-SnaBI (Klenow blunted) fragment from pBS/KIAA0470Δ5'UTR was ligated into pT7-EGFP-C1 (Nigg COM81) digested with XhoI (Klenow blunted). The 3' XhoI site was recreated. This resulted in Addgene plasmid #41150: pEGFP Cep170 (Nigg PID200). The plasmid was then digested with BspEI and XmnI, blunted, and religated to recover a plasmid containing only the Cep170 C-terminal portion (aa 755-1460, from XmnI site to the end of cDNA).

Proper citation: RRID:Addgene_41151 Copy   

•   Source: Addgene

http://www.addgene.org/41245

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ets1a-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGTTTGTGTTTTCTCCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41245 Copy   

•   Source: Addgene

http://www.addgene.org/41187

Species: Saccharomyces cerevisiae
Genetic Insert: S. cerevisiae Hsp82
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pACYC-Duet1 and pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:17908693

Proper citation: RRID:Addgene_41187 Copy   

•   Source: Addgene