Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

328,630 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pLpC-Zipp.-L-IFP-F[1]+Plum (mammalian)
 
Resource Report
Resource Website
RRID:Addgene_52907 Zipp.-L-IFP-F[1]+Plum Deinococcus radiodurans Ampicillin PMID:24747815 Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0
pMos-3xP3DsRed-attP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_52904 Ampicillin PMID:20456509 attP site is gtagtgccccaactggggtaacctttgagttctctcagttgggggcgtag Backbone Size:5935; Vector Backbone:pMos3xP3DsRED; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 2
pLpC-Cat-L-IFP-F[1]+Plum (mammalian)
 
Resource Report
Resource Website
RRID:Addgene_52905 Cat-L-IFP-F[1]+Plum Homo sapiens Ampicillin PMID:24747815 Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-08-15 01:16:26 0
pHL 1011
 
Resource Report
Resource Website
RRID:Addgene_52993 RhyB sRNA E.coli Ampicillin PMID:21189298 Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0
pHL 802
 
Resource Report
Resource Website
RRID:Addgene_52991 OxyS sRNA E.coli Ampicillin PMID:21189298 The pLlacO-1 promoter is induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The LtetO-1 promoter is constitutively transcribed without TetR in the system. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp or mCherry. Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:26 0
pHL 990
 
Resource Report
Resource Website
RRID:Addgene_52992 DsrA sRNA E.coli Ampicillin PMID:21189298 Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:26 0
pHL 762
 
Resource Report
Resource Website
RRID:Addgene_52990 MicC sRNA E.coli Ampicillin PMID:21189298 The pLlacO-1 promoter is induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The LtetO-1 promoter is constitutively transcribed without TetR in the system. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp or mCherry. Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0
pcDNA3-RPS6 (pDD1902)
 
Resource Report
Resource Website
RRID:Addgene_52913 HAS6 Homo sapiens Ampicillin PMID:21734034 Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0
pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimer
 
Resource Report
Resource Website
RRID:Addgene_52878 Channelrhodopsin-2 Chlamydomonas Ampicillin PMID:24674867 Backbone Marker:Stratagene; Backbone Size:5420; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin E90R, D156N, T159C 2026-08-15 01:16:26 0
pHL 1035
 
Resource Report
Resource Website
RRID:Addgene_52999 RhyB sRNA E. coli Ampicillin PMID:21189298 Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0
AaHsp70Bb-1696-FFluc
 
Resource Report
Resource Website
RRID:Addgene_52912 Aa Hsp70B-1696 Aedes aegypti Ampicillin PMID:19496419 Backbone Marker:Promega; Backbone Size:4773; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:16:26 0
pGL3-PUb-SSA
 
Resource Report
Resource Website
RRID:Addgene_52910 Luciferase duplication-TALEN recognition sites Ampicillin PMID:23555893 Backbone Marker:Promega; Backbone Size:6460; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0
pHL 1020
 
Resource Report
Resource Website
RRID:Addgene_52995 RhyB sRNA E.coli Ampicillin PMID:21189298 Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:26 0
pEF-Bos-FLAG MDA5 MI
 
Resource Report
Resource Website
RRID:Addgene_52875 IFIH1 Homo sapiens Ampicillin PMID:19211564 Backbone Size:5500; Vector Backbone:pEF-Bos-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin K335A, E658K 2026-08-15 01:16:25 0
pHL 1022
 
Resource Report
Resource Website
RRID:Addgene_52996 RhyB sRNA E.coli Ampicillin PMID:21189298 Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0
pcDNA3.1(+) prME (JEV) sdm2
 
Resource Report
Resource Website
RRID:Addgene_52881 prME Japanese encephalitis virus Ampicillin PMID:24039574 JEV CH2195 The sequence in this plasmid corresponds to the prM and E genes of Japanese encephalitis virus strain CH2195LA. The reference sequence for this isolate of the virus is GenBank AF221499.1 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin sdm2 2026-08-15 01:16:31 0
pKGAL2-13 WNV PrM-E
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_52882 prM-E west nile virus Ampicillin Vector Backbone:pPSClo; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-08-15 01:16:26 1
pZac2.1 gfaABC1D-lck-GCaMP6f
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_52924 lck-GCaMP6f Ampicillin Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:16:26 25
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_52889 Gal4 Saccharomyces cerevisiae Ampicillin PMID:25605786 Backbone Marker:David Strutt (Brittle et al., 2010); Vector Backbone:pAct5-FRT-stop-FRT-SV40polyA attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 3
pLKO-shAUF1 hairpin 2
 
Resource Report
Resource Website
RRID:Addgene_52922 shRNA targeting AUF1 Homo sapiens Ampicillin PMID:24670723 Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.