Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pLpC-Zipp.-L-IFP-F[1]+Plum (mammalian) Resource Report Resource Website |
RRID:Addgene_52907 | Zipp.-L-IFP-F[1]+Plum | Deinococcus radiodurans | Ampicillin | PMID:24747815 | Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | ||
|
pMos-3xP3DsRed-attP Resource Report Resource Website 1+ mentions |
RRID:Addgene_52904 | Ampicillin | PMID:20456509 | attP site is gtagtgccccaactggggtaacctttgagttctctcagttgggggcgtag | Backbone Size:5935; Vector Backbone:pMos3xP3DsRED; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 2 | |||
|
pLpC-Cat-L-IFP-F[1]+Plum (mammalian) Resource Report Resource Website |
RRID:Addgene_52905 | Cat-L-IFP-F[1]+Plum | Homo sapiens | Ampicillin | PMID:24747815 | Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 0 | ||
|
pHL 1011 Resource Report Resource Website |
RRID:Addgene_52993 | RhyB sRNA | E.coli | Ampicillin | PMID:21189298 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | ||
|
pHL 802 Resource Report Resource Website |
RRID:Addgene_52991 | OxyS sRNA | E.coli | Ampicillin | PMID:21189298 | The pLlacO-1 promoter is induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The LtetO-1 promoter is constitutively transcribed without TetR in the system. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp or mCherry. | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 0 | |
|
pHL 990 Resource Report Resource Website |
RRID:Addgene_52992 | DsrA sRNA | E.coli | Ampicillin | PMID:21189298 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 0 | ||
|
pHL 762 Resource Report Resource Website |
RRID:Addgene_52990 | MicC sRNA | E.coli | Ampicillin | PMID:21189298 | The pLlacO-1 promoter is induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The LtetO-1 promoter is constitutively transcribed without TetR in the system. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp or mCherry. | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | |
|
pcDNA3-RPS6 (pDD1902) Resource Report Resource Website |
RRID:Addgene_52913 | HAS6 | Homo sapiens | Ampicillin | PMID:21734034 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | ||
|
pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimer Resource Report Resource Website |
RRID:Addgene_52878 | Channelrhodopsin-2 | Chlamydomonas | Ampicillin | PMID:24674867 | Backbone Marker:Stratagene; Backbone Size:5420; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | E90R, D156N, T159C | 2026-08-15 01:16:26 | 0 | |
|
pHL 1035 Resource Report Resource Website |
RRID:Addgene_52999 | RhyB sRNA | E. coli | Ampicillin | PMID:21189298 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | ||
|
AaHsp70Bb-1696-FFluc Resource Report Resource Website |
RRID:Addgene_52912 | Aa Hsp70B-1696 | Aedes aegypti | Ampicillin | PMID:19496419 | Backbone Marker:Promega; Backbone Size:4773; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 0 | ||
|
pGL3-PUb-SSA Resource Report Resource Website |
RRID:Addgene_52910 | Luciferase duplication-TALEN recognition sites | Ampicillin | PMID:23555893 | Backbone Marker:Promega; Backbone Size:6460; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | |||
|
pHL 1020 Resource Report Resource Website |
RRID:Addgene_52995 | RhyB sRNA | E.coli | Ampicillin | PMID:21189298 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 0 | ||
|
pEF-Bos-FLAG MDA5 MI Resource Report Resource Website |
RRID:Addgene_52875 | IFIH1 | Homo sapiens | Ampicillin | PMID:19211564 | Backbone Size:5500; Vector Backbone:pEF-Bos-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K335A, E658K | 2026-08-15 01:16:25 | 0 | |
|
pHL 1022 Resource Report Resource Website |
RRID:Addgene_52996 | RhyB sRNA | E.coli | Ampicillin | PMID:21189298 | Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 | ||
|
pcDNA3.1(+) prME (JEV) sdm2 Resource Report Resource Website |
RRID:Addgene_52881 | prME | Japanese encephalitis virus | Ampicillin | PMID:24039574 | JEV CH2195 The sequence in this plasmid corresponds to the prM and E genes of Japanese encephalitis virus strain CH2195LA. The reference sequence for this isolate of the virus is GenBank AF221499.1 | Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | sdm2 | 2026-08-15 01:16:31 | 0 |
|
pKGAL2-13 WNV PrM-E Resource Report Resource Website 1+ mentions |
RRID:Addgene_52882 | prM-E | west nile virus | Ampicillin | Vector Backbone:pPSClo; Vector Types:Unspecified; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 1 | |||
|
pZac2.1 gfaABC1D-lck-GCaMP6f Resource Report Resource Website 10+ mentions |
RRID:Addgene_52924 | lck-GCaMP6f | Ampicillin | Vector Backbone:pZac2.1; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:26 | 25 | ||||
|
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB Resource Report Resource Website 1+ mentions |
RRID:Addgene_52889 | Gal4 | Saccharomyces cerevisiae | Ampicillin | PMID:25605786 | Backbone Marker:David Strutt (Brittle et al., 2010); Vector Backbone:pAct5-FRT-stop-FRT-SV40polyA attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 3 | ||
|
pLKO-shAUF1 hairpin 2 Resource Report Resource Website |
RRID:Addgene_52922 | shRNA targeting AUF1 | Homo sapiens | Ampicillin | PMID:24670723 | Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-15 01:16:31 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.