Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: HSA-hGH fusion protein and TEV protease
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104948 Copy
Genetic Insert: hGH and G-CSF
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104947 Copy
Genetic Insert: HSA and hGH
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104946 Copy
Genetic Insert: anti-CTLA4
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104951 Copy
Genetic Insert: hGH, Interferon and G-CSF
Vector Backbone Description: Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29311542
Proper citation: RRID:Addgene_104953 Copy
Species: Mus musculus
Genetic Insert: IgG2b heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4489; Vector Backbone:pFUSEss-CHIg-mG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105930 Copy
Species: Mus musculus
Genetic Insert: IgG2b
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4517; Vector Backbone:pFUSEss-CHIg-mG2b; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105931 Copy
Species: Mus musculus
Genetic Insert: IgG1, IgG3
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4477; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105859 Copy
Species: Mus musculus
Genetic Insert: IgG1, IgG3
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105857 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105855 Copy
Species: Mus musculus
Genetic Insert: IgG1 heavy chain, IgG3 heavy chain
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4480; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29875771
Proper citation: RRID:Addgene_105853 Copy
Species: BK polyomavirus
Genetic Insert: BKV-IV VP1
Vector Backbone Description: Backbone Marker:Gusteau Research Corporation; Backbone Size:7000; Vector Backbone:pGustiv; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Proper citation: RRID:Addgene_252216 Copy
Vector Backbone Description: Backbone Marker:Host-Microbe Interactions lab; Backbone Size:2147; Vector Backbone:pUdO3z; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:38235654
Proper citation: RRID:Addgene_210252 Copy
Vector Backbone Description: Backbone Size:1986; Vector Backbone:pREMI-Z; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:11856375
Comments: Linearize at BamHI.
Proper citation: RRID:Addgene_59527 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pPICZA; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61324 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61323 Copy
Species: Other
Genetic Insert: Siwi
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19460866
Proper citation: RRID:Addgene_50560 Copy
Species: Homo sapiens
Genetic Insert: L1 ORF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:22918960
Comments: Although a myc tag is present in the full sequence, this tag is not present in this plasmid.
pBudORF1-CH was generated by cloning the polymerase chain reaction (PCR)-amplified codon-optimized consensus sequences of each ORF into the HindIII-BamHI sites of the pBudCE4.1 vector in a manner that removes the stop codon of the ORF1, so the expressed protein will contain the his tag at the carboxy terminus. The following primers were used in the amplification of ORF1: 5-AGACCCAAGCTTAGCTAAAACCACAAAGATG-3′ and 5-TGTTCGGATCCGATCTTGGTGTGCTTCTGCAGGGG-3′
Proper citation: RRID:Addgene_51290 Copy
Species: NA
Genetic Insert: Tandem dual tomato
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:17603495
Proper citation: RRID:Addgene_48735 Copy
Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:24076762
Proper citation: RRID:Addgene_48678 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
