Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pOPINA Resource Report Resource Website 1+ mentions |
RRID:Addgene_41141 | Kanamycin | Backbone Marker:Merck; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:42 | 1 | |||||
|
pCAGIG-6xHIS.Mm.RPE65-eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_41019 | RPE65 | Mus musculus | Ampicillin | This plasmid expresses EGFP as a reporter gene from IRES as part of the bicistronic transcript | Backbone Marker:Connie Cepko (Addgene plasmid #11159); Backbone Size:6135; Vector Backbone:pCAGIG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:41 | 1 | ||
|
pOPINP Resource Report Resource Website 1+ mentions |
RRID:Addgene_41139 | Ampicillin | Backbone Marker:Merck; Vector Backbone:ptriex2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 1 | |||||
|
pcold-6xHis-HRV3Csite-DmLoqsPA Resource Report Resource Website 1+ mentions |
RRID:Addgene_41093 | Loquacious-PA | Drosophila melanogaster | Ampicillin | PMID:23063653 | Backbone Marker:Takara; Backbone Size:6000; Vector Backbone:pcold1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:41 | 1 | ||
|
hSyn1-FLEX-hChR2-tdtomato Resource Report Resource Website 1+ mentions |
RRID:Addgene_41015 | Channelrhodopsin-2 | Chlamydomonas reinhardtii | Ampicillin | Backbone Size:4971; Vector Backbone:pAAV (Adeno-associated Virus); Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin | codon-optimized (human) | 2026-08-15 01:14:41 | 2 | ||
|
pcold-6xHis-HRV3Csite-HsTRBP Resource Report Resource Website 1+ mentions |
RRID:Addgene_41096 | TRBP | Homo sapiens | Ampicillin | PMID:23063653 | Backbone Marker:Takara; Backbone Size:6000; Vector Backbone:pcold1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:41 | 1 | ||
|
pOPINE-3C-HALO7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41126 | Ampicillin | Backbone Marker:Merck; Vector Backbone:ptriex2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 1 | |||||
|
pCS2+ YFP-Smo Resource Report Resource Website 1+ mentions |
RRID:Addgene_41086 | smoothened homolog | Mus musculus | Ampicillin | PMID:22981989 | Backbone Size:4078; Vector Backbone:pCS2+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | YFP inserted after Smo signal sequence | 2026-08-15 01:14:41 | 3 | |
|
pOPINHALO7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41117 | Ampicillin | PMID:21856427 | Backbone Marker:Merck; Vector Backbone:ptriex2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 2 | ||||
|
pOPINS3C Resource Report Resource Website 1+ mentions |
RRID:Addgene_41115 | Ampicillin | PMID:21856427 | There is a minor gap between depositor's reference sequence and Addgene's quality control sequence. The gap does not affect SUMO ORF. | Backbone Marker:Merck; Vector Backbone:ptriex2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 5 | |||
|
pTKIP-cat Resource Report Resource Website 1+ mentions |
RRID:Addgene_41065 | Chloramphenicol and Ampicillin | PMID:20047970 | Backbone Size:4146; Vector Backbone:pTKIP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:41 | 1 | ||||
|
TAL3035 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41209 | ZebrafishCommunity-bsx-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TATCTCTGGATCTCGAAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 1 | |
|
pcDNA3 PBD HK-AA (Nigg AH13) Resource Report Resource Website 1+ mentions |
RRID:Addgene_41161 | PBD HK-AA | Homo sapiens | Ampicillin | PMID:16267267 | Addgene plasmid #41162: Plk1-PBDWT (aa 326–603) was cloned in-frame by PCR into a pcDNA3.1 vector encoding an amino-terminal 3xmyc-tag (Invitrogen, Carlsbad, CA) using primers 5'-CCG GAA TTC CAG ATC TTC GAT TGC TCC CAG CAG CCT GG-3' and 5'-CCG CTC GAG TTA GGA GGC CTT GAG ACG GTT GC-3'. The Plk1-PBDAA mutant (H538A, K540A) was made by site-directed mutagenesis using the following primers: 5'-CAA TTC TCC GGA GCC CCG CCT ATC TGT CCC-3' and 5'-GGG ACA GAT AGG CGG GGC TCC GGA GAA TTG-3'. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1/3x myc-C; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Contains Plk1-PBD only (aa 326–603); HK-AA (H538A, K540A) | 2026-08-15 01:14:42 | 1 |
|
pRcCMV myc-Plk1 wt (Nigg RG6) Resource Report Resource Website 1+ mentions |
RRID:Addgene_41160 | Plk1 | Homo sapiens | Ampicillin | PMID:7962193 | cDNA fragments spanning parts of the catalytic domains of human protein kinases were amplified by PCR, as described by Schultz and Nigg (1993). A 144 bp fragment (named HsPK28) showing 88% nucleotide identity to Drosophila polo was used to probe a λgt 10 library prepared from a human nasopharyngeal carcinoma (Hitt et al., 1989). Approximately 500,000 plaques were screened by plaque hybridization (Sambrook et al., 1989), and 17 phage showing strong hybridization were purified. DNA was prepared using Lambdasorb (Promega Biotech, Madison, WI). One plasmid (referred to as Plk1-pGEM) with a 2143 bp insert contained the entire coding sequence for a protein kinase closely related to Drosophila polo. This insert was sequenced on both strands by the method of Chen and Seeburg (1985), using the Sequenase kit (United States Biochemicals). To express a full-length Plk1 protein, the 1998 bp fragment of Plk1-pGEM was introduced into the pRc/CMV vector (Invitrogen Corporation, San Diego), to create Plk1-CMV. An N-terminally myc-tagged Plk1-CMV was also constructed. In the resulting mycplk1 protein, the N terminus of Plk1 is extended by the oligopeptide MEQKLISEEDLNMNSCSPGS (Evan et al., 1985). | Backbone Marker:Invitrogen; Backbone Size:5527; Vector Backbone:pRc/CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 5 | |
|
pEGFP Rootletin (Nigg pFL2(CW499)) Resource Report Resource Website 1+ mentions |
RRID:Addgene_41166 | Rootletin | Homo sapiens | Kanamycin | PMID:16203858 | The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing. | Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:42 | 5 | |
|
pEGFP PICH (Nigg CB62) Resource Report Resource Website 1+ mentions |
RRID:Addgene_41163 | PICH | Homo sapiens | Kanamycin | PMID:17218258 | The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:42 | 5 | |
|
pRcCMV Cep215 (Nigg CW493) Resource Report Resource Website 1+ mentions |
RRID:Addgene_41152 | Cep215 | Homo sapiens | Kanamycin | PMID:18042621 | The Cep215 cDNA sequence was obtained from KIAA1633 clone (from Kazusa DNA Research Institute). Using PCR, a frameshift within the sequence was corrected and missing 5' coding information was obtained by PCR amplification from Marathon cDNA library (Clontech). Constructs were fused to yield the complete coding sequence of Cep215, and subcloned into a mammalian expression vector providing a Myc epitope-tag. All constructs were confirmed by sequencing. | Backbone Marker:Modified from Clontech; Backbone Size:4110; Vector Backbone:pCJW206 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:42 | 4 | |
|
pEGFP Cep170 C-term (Nigg GG2) Resource Report Resource Website 1+ mentions |
RRID:Addgene_41151 | Cep170 | Homo sapiens | Kanamycin | PMID:15616186 | The KIAA0470 cDNA was obtained from the Kazusa DNA Research Institute. It was subcloned into pT7-EGFP-C1 (modified from pEGFP-C1; BD Biosciences Clontech), after removing the ATG. Specifically, a 5kb SalI-SnaBI (Klenow blunted) fragment from pBS/KIAA0470Δ5'UTR was ligated into pT7-EGFP-C1 (Nigg COM81) digested with XhoI (Klenow blunted). The 3' XhoI site was recreated. This resulted in Addgene plasmid #41150: pEGFP Cep170 (Nigg PID200). The plasmid was then digested with BspEI and XmnI, blunted, and religated to recover a plasmid containing only the Cep170 C-terminal portion (aa 755-1460, from XmnI site to the end of cDNA). | Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pEGFP-T7/C1 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Contains C-terminal fragment (aa 755-1460, from XmnI site to the end of cDNA), | 2026-08-15 01:14:42 | 1 |
|
TAL3071 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41245 | ZebrafishCommunity-ets1a-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTGTTTGTGTTTTCTCCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 1 | |
|
pACYC-T7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41187 | S. cerevisiae Hsp82 | Saccharomyces cerevisiae | Chloramphenicol | PMID:17908693 | Backbone Size:4500; Vector Backbone:pACYC-Duet1 and pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-08-15 01:14:42 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
