Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 281 showing 5601 ~ 5620 out of 12,972 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_32487

http://www.addgene.org/32487

Species: Mus musculus
Genetic Insert: GPD1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21555452

Proper citation: RRID:Addgene_32487 Copy   


  • RRID:Addgene_207408

http://www.addgene.org/207408

Species: Mus musculus
Genetic Insert: ActB
Vector Backbone Description: Vector Backbone:pS23.U6; Vector Types:Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37713292
Comments: Please visit https://doi.org/10.1101/2020.07.15.199620 for bioRxiv preprint.

Proper citation: RRID:Addgene_207408 Copy   


  • RRID:Addgene_209560

http://www.addgene.org/209560

Species: Mus musculus
Genetic Insert: Shtn1 long isoform
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30733148

Proper citation: RRID:Addgene_209560 Copy   


http://www.addgene.org/209060

Species: Mus musculus
Genetic Insert: sgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway vector to be used for LR reaction; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:37591951

Proper citation: RRID:Addgene_209060 Copy   


  • RRID:Addgene_206026

http://www.addgene.org/206026

Species: Mus musculus
Genetic Insert: ORF2 derived from mouse LINE1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pZeoSV2(+); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33938150

Proper citation: RRID:Addgene_206026 Copy   


http://www.addgene.org/210017

Species: Mus musculus
Genetic Insert: Sox2AV-t2a-Klf4-e2a-cMyc
Vector Backbone Description: Backbone Size:10180; Vector Backbone:pCXLE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38141611
Comments: Deliver to your PSCs combined with pCXWB-EBNA1 (Addgene #37624) Please visit https://www.biorxiv.org/content/10.1101/2022.09.23.509242v1 for BioRxiv preprint

Proper citation: RRID:Addgene_210017 Copy   


http://www.addgene.org/197336

Species: Mus musculus
Genetic Insert: TRIP8b (1b-2)
Vector Backbone Description: Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: This is a validated antigen plasmid of Anti-TRIP8b (constant) [N212/17R].

Proper citation: RRID:Addgene_197336 Copy   


http://www.addgene.org/212080

Species: Mus musculus
Genetic Insert: Chtop-exon
Vector Backbone Description: Vector Backbone:5'-3xFLAG minimal CMV pCDNA5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38065061

Proper citation: RRID:Addgene_212080 Copy   


  • RRID:Addgene_210337

http://www.addgene.org/210337

Species: Mus musculus
Genetic Insert: mTSPAN9
Vector Backbone Description: Vector Backbone:pB-CAG-BGH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34048705

Proper citation: RRID:Addgene_210337 Copy   


  • RRID:Addgene_208612

    This resource has 1+ mentions.

http://www.addgene.org/208612

Species: Mus musculus
Genetic Insert: CRY2clust-mCherry-RANK
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:5731; Vector Backbone:pCAG-WPRE/N1 (modified pEGFP-N1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38242937

Proper citation: RRID:Addgene_208612 Copy   


  • RRID:Addgene_214268

http://www.addgene.org/214268

Species: Mus musculus
Genetic Insert: dTomato-ORP9(1-111)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3945; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38846081
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.12.14.571782v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_214268 Copy   


  • RRID:Addgene_204499

http://www.addgene.org/204499

Species: Mus musculus
Genetic Insert: Glis1
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38331995
Comments: The NL fragment was obtained from pMaster3 (Addgene plasmid #58526) (Wu et al., 2014)

Proper citation: RRID:Addgene_204499 Copy   


http://www.addgene.org/215751

Species: Mus musculus
Genetic Insert: 2xHP1bCD_W42A-IFP2.0C
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38554702

Proper citation: RRID:Addgene_215751 Copy   


  • RRID:Addgene_208286

http://www.addgene.org/208286

Species: Mus musculus
Genetic Insert: Cry2 - mCherry - Profilin.WT
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4018; Vector Backbone:mCherry N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38457348
Comments: Please visit https://doi.org/10.1101/2023.10.04.560945 for bioRxiv preprint.

Proper citation: RRID:Addgene_208286 Copy   


http://www.addgene.org/214990

Species: Mus musculus
Genetic Insert: EEA1
Vector Backbone Description: Vector Backbone:pUC-GW-Amp; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Comments: Target site is: CCGGCCAAACCATGTTTCGAAGG (AGG is the PAM). Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.

Proper citation: RRID:Addgene_214990 Copy   


http://www.addgene.org/182718

Species: Mus musculus
Genetic Insert: desmoglein-3
Vector Backbone Description: Vector Backbone:pcdna 3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40740498
Comments: Please visit https://doi.org/10.1101/2024.05.03.592394 for bioRxiv preprint.

Proper citation: RRID:Addgene_182718 Copy   


  • RRID:Addgene_217815

http://www.addgene.org/217815

Species: Mus musculus
Genetic Insert: ITGB5
Vector Backbone Description: Vector Backbone:pD2529 CAG; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38889315
Comments: Please visit https://doi.org/10.1101/2024.01.26.577394 for bioRxiv preprint.

Proper citation: RRID:Addgene_217815 Copy   


  • RRID:Addgene_218801

http://www.addgene.org/218801

Species: Mus musculus
Genetic Insert: Ap1 g1
Vector Backbone Description: Vector Backbone:pBeta-Actin-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38446634
Comments: pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.

Proper citation: RRID:Addgene_218801 Copy   


  • RRID:Addgene_209519

http://www.addgene.org/209519

Species: Mus musculus
Genetic Insert: Ptgs2
Vector Backbone Description: Backbone Size:4283; Vector Backbone:pGL4.23; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38635533

Proper citation: RRID:Addgene_209519 Copy   


  • RRID:Addgene_209520

http://www.addgene.org/209520

Species: Mus musculus
Genetic Insert: Mmp11 promoter
Vector Backbone Description: Backbone Size:4283; Vector Backbone:pGL4.23; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38635533

Proper citation: RRID:Addgene_209520 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X