Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA-LBR-mRFP1-polyA Resource Report Resource Website |
RRID:Addgene_59749 | LBR-mRFP1 | Mus musculus | Ampicillin | PMID:24908396 | Vector Backbone:pcDNA3.1-polyA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 1-249 of LBR | 2026-08-25 09:24:14 | 0 | |
|
pX330 Ctnnb1.1 Resource Report Resource Website |
RRID:Addgene_59911 | sgRNA targeting Ctnnb1 | Mus musculus | Ampicillin | PMID:25119044 | Backbone Marker:Feng Zhang lab (Addgene plasmid # 42230); Backbone Size:8500; Vector Backbone:pX330; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:15 | 0 | ||
|
pNICE HA-mSYD1B Resource Report Resource Website 1+ mentions |
RRID:Addgene_59362 | mSYD1B | Mus musculus | Kanamycin | PMID:23791195 | mSYD1B can be released without HA-tag (by XhoI / BamHI) or with HA-tag (e.g. by AgeI / BamHI). | Backbone Size:3984; Vector Backbone:pNICE-HA-N; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:24:12 | 1 | |
|
Myopathy Loop Mutant Nuclear Myosin I YFP Resource Report Resource Website |
RRID:Addgene_60243 | Nuclear Myosin 1 | Mus musculus | Kanamycin | PMID:16631592 | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Deleted I339, I340, G343, E344, E345,L346 | 2026-08-25 09:24:17 | 0 | |
|
E407V Nuclear Myosin I YFP Resource Report Resource Website |
RRID:Addgene_60242 | Nuclear Myosin 1 | Mus musculus | Kanamycin | PMID:16631592 | Backbone Marker:Clonetech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | E407V | 2026-08-25 09:24:17 | 0 | |
|
CRY2olig-mCh-CLC Resource Report Resource Website |
RRID:Addgene_60035 | CRY2-mCh-Clathrin Light Chain | Mus musculus | Kanamycin | PMID:25233328 | *This plasmid contains clathrin light chain A, isoform a, with an A9D mutation relative to NM_001080384 (NP_001073853). This mutation, however, seems to be a natural variant, as it is present in other published sequences for mouse Clta | Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pmCherryN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | M354I, E490G CRY2, A9D* | 2026-08-25 09:24:16 | 0 |
|
Nanog-2A-mCherry Resource Report Resource Website 10+ mentions |
RRID:Addgene_59995 | Nanog | Mus musculus | Ampicillin | PMID:23827708 | Vector Backbone:PCR2_TOPO; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:16 | 10 | ||
|
pCAG-Kir2.1-T2A-tdTomato Resource Report Resource Website 10+ mentions |
RRID:Addgene_60598 | Kir2.1-T2A-tdTomato | Mus musculus | Ampicillin | PMID:25043046 | Backbone Size:5008; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:19 | 14 | ||
|
pmIL-6 mut AP-1+C/EBP Resource Report Resource Website |
RRID:Addgene_61292 | IL-6 promoter | Mus musculus | Ampicillin | PMID:12626566 | Contains point mutations in both AP-1 and C/EBP binding sites. See Table 1 of associated publication for more details. Full sequence and map is available for wild-type vector pmIL-6 FL (Plasmid #61290) | Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | Mutated both AP-1 binding site from TGAGTCT to TGCAGCT and C/EBP binding site from ACATTGTGCAATCT to ACAGATATCAATCT | 2026-08-25 09:24:24 | 0 |
|
pcDNA3-Tet2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_60939 | Ten-Eleven Translocation 2 | Mus musculus | Ampicillin | PMID:24412366 | *modified pcDNA3 vector with a beta globulin intron inserted. This insertion can help stabilize the transcripts and is particularly useful for the expression of large genes, such as p300 and Tet proteins | Backbone Size:5400; Vector Backbone:pcDNA3*; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:22 | 10 | |
|
pcDNA-Flag-Tet3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_60940 | Ten-Eleven Translocation 3 | Mus musculus | Ampicillin | PMID:24412366 | Backbone Size:6000; Vector Backbone:pcDNA-flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:22 | 4 | ||
|
pmIL-6 FL Resource Report Resource Website 1+ mentions |
RRID:Addgene_61286 | IL-6 promoter | Mus musculus | Ampicillin | PMID:12626566 | Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:24 | 8 | ||
|
pcDNA3.1 Flag-Sesn1b Resource Report Resource Website |
RRID:Addgene_61867 | Sesn1 | Mus musculus | Ampicillin | PMID:25259925 | Backbone Size:6000; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | none | 2026-08-25 09:24:28 | 0 | |
|
pcDNA3.1 Flag-Sesn2 Resource Report Resource Website |
RRID:Addgene_61868 | Sesn2 | Mus musculus | Ampicillin | PMID:25259925 | Backbone Size:6000; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | none | 2026-08-25 09:24:28 | 0 | |
|
px335 Mettl14 sgRNA #2 Resource Report Resource Website |
RRID:Addgene_61514 | gccgctcccggatctcctgc | Mus musculus | Ampicillin | PMID:25569111 | Vector Backbone:px335; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:26 | 0 | ||
|
pcDNA-flag-mZscan4d-polyA Resource Report Resource Website |
RRID:Addgene_61831 | Zscan4d | Mus musculus | Ampicillin | PMID:25417163 | Backbone Size:5700; Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:28 | 0 | ||
|
pEF5-FRT-TagRFP-T-IFT88 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61684 | IFT88 | Mus musculus | Ampicillin | PMID:23930224 | Vector Backbone:pEF5-FRT-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:24:27 | 4 | ||
|
pIRESh-GFPII-S-Dlk1 Resource Report Resource Website |
RRID:Addgene_108931 | Dlk1 | Mus musculus | Kanamycin | PMID:21776083 | Backbone Marker:Invitrogen; Vector Backbone:pIRESh-GFPII; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | contains sequences from full length Dlk1A up to the juxtamembrane cleavage domain (amino acid 303) | 2026-08-25 09:04:13 | 0 | |
|
pCAG-ChroME-mRuby2-ST Resource Report Resource Website 1+ mentions |
RRID:Addgene_108902 | ChroME-mRuby2-ST | Mus musculus | Ampicillin | PMID:29713079 | Backbone Size:5855; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-25 09:04:13 | 2 | ||
|
pTubulin-BC2T Resource Report Resource Website |
RRID:Addgene_108970 | a-tubulin | Mus musculus | Kanamycin | PMID:29500346 | Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-25 09:04:14 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
