Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: None
Vector Backbone Description: Backbone Size:6969; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a SLIC cloning protocol.
Prescission is a highly specific protease that cleaves LEVLFQ/GP. It is generally more active than TEV protease, and many users have found that when their protein inhibits TEV cleavage, switching to a prescission vector has proved worthwhile.
To clone into this vector, add SLIC tags to the 5' end of your PCR primers.
Forward - 5'GTGCTGTTCCAGGGTCCGAAT3'
Reverse - 5'TGGTGGTGGTGGTGCTCGA(TTA)3'
Linearize the plasmid with SspI and XhoI, then gel purify. There is a 1650 bp stuffer sequence that will be visible on a gel.
When digesting the DNA with T4 polymerase, use no nucleotides for either your insert or the linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29720 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5661; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Sumo can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/macrolab/
Proper citation: RRID:Addgene_29659 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5712; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Mocr can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29658 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:6846; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. NusA can enhance the expression and solubility of your protein.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29657 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:6465; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. MBP can enhance your protein's solubility and expression. It can also be used as an affinity tag.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29656 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:6015; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. GST can be used to enhance your protein's expression and solubility. It can also be used as an affinity tag.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29655 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5343; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29653 Copy
Genetic Insert: no insert
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2830; Vector Backbone:pENTR4; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Sequence verified, no further characterization.
Proper citation: RRID:Addgene_29650 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5352; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable Strep II fusion tag on its N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/macrolab/
Proper citation: RRID:Addgene_29664 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:6075; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/macrolab/
Proper citation: RRID:Addgene_29663 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5340; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable FLAG fusion tag on its N-terminus.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29662 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5895; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Gamma crystallin can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29661 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:5532; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. Protein G can enhance the expression and solubility of your protein of interest.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29660 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4470; Vector Backbone:pDONR201; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18248826
Comments: This plasmid is a DelsGate vector that contains a selectable marker for the transformation of Basidiomycete fungi.
Proper citation: RRID:Addgene_29636 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4470; Vector Backbone:pDONR201; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18248826
Comments: This plasmid contains a selectable marker for U. maydis transformation and was constructed by inserting a ~2.3 kb EcoICRI carboxin
resistance (cbxR) conferring fragment from pGR3 (kindly provided by J. Hargreaves) into the blunt ended NspI site of pDONR201.
Proper citation: RRID:Addgene_29634 Copy
Genetic Insert: BirA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2266; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: The BirA gene was amplified from the E.coli TOP10F' strain, sequence confirmed, and functionally tested in E.coli using a protein fused to an AviTag.
Please note that using this plasmid in a LR reaction with a Destination vector encoding an N-terminal tag is not recommended as it would not be in frame with the BirA sequence. This plasmid was designed to be used to biotinylate substrates in vivo. To add a tag to BirA, clone the desired tag into the vector itself, rather than using Gateway cloning--this approach will also prevent unnecessary sequence in the expressed protein.
Proper citation: RRID:Addgene_29645 Copy
Vector Backbone Description: Backbone Size:6088; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
GFP has a excitation max of 489 nm and an emission max of 510 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29725 Copy
Vector Backbone Description: Backbone Size:6088; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mCitrine has a excitation max of 515 nm and an emission max of 529 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29724 Copy
Vector Backbone Description: Backbone Size:6082; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mOrange has a excitation max of 548 nm and an emission max of 562 nm.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29723 Copy
Vector Backbone Description: Backbone Size:7276; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mCerulean has a excitation max of 435 nm and an emission max of 477 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29751 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
