Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,517 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_97308 Actb HMEJ donor Synthetic Ampicillin PMID:28524166 INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:22:34 2
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_97310 Actb NHEJ donor Synthetic Ampicillin PMID:28524166 INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin 2026-08-15 01:22:34 1
AAV_Actb HR donor
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_97317 Actb HR donor Synthetic Ampicillin and Kanamycin PMID:28524166 Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:34 2
AAV_Actb HMEJ donor
 
Resource Report
Resource Website 		RRID:Addgene_97318 Actb HMEJ donor Synthetic Ampicillin and Kanamycin PMID:28524166 gRNA sequence: agtccgcctagaagcacttg Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:34 0
AAV_Dbh HMEJ donor
 
Resource Report
Resource Website 		RRID:Addgene_97320 Dbh HMEJ donor Synthetic Ampicillin and Kanamycin PMID:28524166 gRNA sequence: agaatagcttctcacaaggt Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-15 01:22:34 0
pMSP1D1Q1
 
Resource Report
Resource Website 		RRID:Addgene_97326 MSP1D1Q1 Synthetic Kanamycin Backbone Size:5300; Vector Backbone:pET 28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin Addition of Q residue after T25 2026-08-15 01:22:34 0
PEP101E
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_97387 sfGFP1-10OPT Synthetic Kanamycin PMID:28619883 Addgene’s sequencing results found an insertion of IS4 transposase in this vector not annotated in the original sequence. The depositor has verified that this vector is functional for target gene expression. Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:34 1
nucHCB1
 
Resource Report
Resource Website 		RRID:Addgene_97424 nucHCB1 Synthetic Kanamycin PMID:28017939 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peYFPN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:35 0
SPDK3181
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_97403 ER-sfCherry1-10 Synthetic Kanamycin PMID:28619883 Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:34 1
PEP116E
 
Resource Report
Resource Website 		RRID:Addgene_97402 mCherry-sfGFP11 Synthetic Kanamycin PMID:28619883 Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:34 0
SPDK3182
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_97404 ER-sfYFP1-10 Synthetic Kanamycin PMID:28619883 Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:35 1
SPDK3214
 
Resource Report
Resource Website 		RRID:Addgene_97406 ER-GUS-sfCherry11 Synthetic Kanamycin PMID:28619883 Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:34 0
pRVdG-4GCaMP6f
 
Resource Report
Resource Website 		RRID:Addgene_98035 GCaMP6f Synthetic Ampicillin PMID:29507411 Backbone Marker:Karl-Klaus Conzelmann & Matthias Schnell; Vector Backbone:cSPBN (pSAD); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:35 0
pRVdG-4Cre
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98034 mCre Synthetic Ampicillin PMID:29507411 Backbone Marker:Karl-Klaus Conzelmann & Matthias Schnell; Vector Backbone:cSPBN (pSAD); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:35 1
pRVdGL-1EGFP
 
Resource Report
Resource Website 		RRID:Addgene_98036 EGFP Synthetic Ampicillin PMID:29507411 Backbone Marker:Karl-Klaus Conzelmann & Matthias Schnell; Vector Backbone:cSPBN (pSAD); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:22:35 0
PEP106E
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_97392 sfGFP1-10OPT Synthetic Kanamycin PMID:28619883 Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:35 1
AAV2_hSyn_Phobos_Citrine
 
Resource Report
Resource Website 		RRID:Addgene_98216 Synthetic construct Phobos gene Synthetic Ampicillin PMID:29097684 Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint. Backbone Size:5303; Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin T59S, E83N, E90Q, E101S, V117R, E123S, T159G, G163A, V242R, T246N, N258Q, E273S 2026-08-15 01:22:36 0
AAV2_hSyn_Phobos_CA_Citrine
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98218 Synthetic construct Phobos_C128A gene Synthetic Ampicillin PMID:29097684 Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint. Backbone Size:5303; Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin T59S, E83N, E90Q, E101S, V117R, E123S, C128A, T159G, G163A, V242R, T246N, N258Q, E273S 2026-08-15 01:22:37 1
nucHCB2
 
Resource Report
Resource Website 		RRID:Addgene_98581 HCB2 Synthetic Kanamycin PMID:28017939 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peYFPN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:39 0
HCB2
 
Resource Report
Resource Website 		RRID:Addgene_98583 HCB2 Synthetic Kanamycin PMID:28017939 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peYFPN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:22:40 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch