Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 282 showing 5621 ~ 5640 out of 30,517 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/97308

Species: Synthetic
Genetic Insert: Actb HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28524166
Comments: INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb

Proper citation: RRID:Addgene_97308 Copy   


http://www.addgene.org/97310

Species: Synthetic
Genetic Insert: Actb NHEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28524166
Comments: INSERT2:EGFP driven by EF1a promoter; INSERT3:U6-driven sgRNAs targeting Actb

Proper citation: RRID:Addgene_97310 Copy   


  • RRID:Addgene_97317

    This resource has 1+ mentions.

http://www.addgene.org/97317

Species: Synthetic
Genetic Insert: Actb HR donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166

Proper citation: RRID:Addgene_97317 Copy   


  • RRID:Addgene_97318

http://www.addgene.org/97318

Species: Synthetic
Genetic Insert: Actb HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agtccgcctagaagcacttg

Proper citation: RRID:Addgene_97318 Copy   


  • RRID:Addgene_97320

http://www.addgene.org/97320

Species: Synthetic
Genetic Insert: Dbh HMEJ donor
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:28524166
Comments: gRNA sequence: agaatagcttctcacaaggt

Proper citation: RRID:Addgene_97320 Copy   


  • RRID:Addgene_97326

http://www.addgene.org/97326

Species: Synthetic
Genetic Insert: MSP1D1Q1
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pET 28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_97326 Copy   


  • RRID:Addgene_97387

    This resource has 1+ mentions.

http://www.addgene.org/97387

Species: Synthetic
Genetic Insert: sfGFP1-10OPT
Vector Backbone Description: Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28619883
Comments: Addgene’s sequencing results found an insertion of IS4 transposase in this vector not annotated in the original sequence. The depositor has verified that this vector is functional for target gene expression.

Proper citation: RRID:Addgene_97387 Copy   


  • RRID:Addgene_97424

http://www.addgene.org/97424

Species: Synthetic
Genetic Insert: nucHCB1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peYFPN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28017939

Proper citation: RRID:Addgene_97424 Copy   


  • RRID:Addgene_97403

    This resource has 1+ mentions.

http://www.addgene.org/97403

Species: Synthetic
Genetic Insert: ER-sfCherry1-10
Vector Backbone Description: Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28619883

Proper citation: RRID:Addgene_97403 Copy   


  • RRID:Addgene_97402

http://www.addgene.org/97402

Species: Synthetic
Genetic Insert: mCherry-sfGFP11
Vector Backbone Description: Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28619883

Proper citation: RRID:Addgene_97402 Copy   


  • RRID:Addgene_97404

    This resource has 1+ mentions.

http://www.addgene.org/97404

Species: Synthetic
Genetic Insert: ER-sfYFP1-10
Vector Backbone Description: Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28619883

Proper citation: RRID:Addgene_97404 Copy   


  • RRID:Addgene_97406

http://www.addgene.org/97406

Species: Synthetic
Genetic Insert: ER-GUS-sfCherry11
Vector Backbone Description: Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28619883

Proper citation: RRID:Addgene_97406 Copy   


  • RRID:Addgene_98035

http://www.addgene.org/98035

Species: Synthetic
Genetic Insert: GCaMP6f
Vector Backbone Description: Backbone Marker:Karl-Klaus Conzelmann & Matthias Schnell; Vector Backbone:cSPBN (pSAD); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29507411

Proper citation: RRID:Addgene_98035 Copy   


  • RRID:Addgene_98034

    This resource has 1+ mentions.

http://www.addgene.org/98034

Species: Synthetic
Genetic Insert: mCre
Vector Backbone Description: Backbone Marker:Karl-Klaus Conzelmann & Matthias Schnell; Vector Backbone:cSPBN (pSAD); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29507411

Proper citation: RRID:Addgene_98034 Copy   


  • RRID:Addgene_98036

http://www.addgene.org/98036

Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Karl-Klaus Conzelmann & Matthias Schnell; Vector Backbone:cSPBN (pSAD); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29507411

Proper citation: RRID:Addgene_98036 Copy   


  • RRID:Addgene_97392

    This resource has 1+ mentions.

http://www.addgene.org/97392

Species: Synthetic
Genetic Insert: sfGFP1-10OPT
Vector Backbone Description: Vector Backbone:pCAMBIA1380; Vector Types:Plant Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28619883

Proper citation: RRID:Addgene_97392 Copy   


http://www.addgene.org/98216

Species: Synthetic
Genetic Insert: Synthetic construct Phobos gene
Vector Backbone Description: Backbone Size:5303; Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097684
Comments: Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint.

Proper citation: RRID:Addgene_98216 Copy   


  • RRID:Addgene_98218

    This resource has 1+ mentions.

http://www.addgene.org/98218

Species: Synthetic
Genetic Insert: Synthetic construct Phobos_C128A gene
Vector Backbone Description: Backbone Size:5303; Vector Backbone:pAAV2; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097684
Comments: Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint.

Proper citation: RRID:Addgene_98218 Copy   


  • RRID:Addgene_98581

http://www.addgene.org/98581

Species: Synthetic
Genetic Insert: HCB2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peYFPN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28017939

Proper citation: RRID:Addgene_98581 Copy   


  • RRID:Addgene_98583

http://www.addgene.org/98583

Species: Synthetic
Genetic Insert: HCB2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:peYFPN1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28017939

Proper citation: RRID:Addgene_98583 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X