Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mOrange has a excitation max of 548 nm and an emission max of 562 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29748 Copy
Vector Backbone Description: Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
mCherry has a excitation max of 587 nm and an emission max of 610 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_29747 Copy
Genetic Insert: APLP1 shRNA 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18573216
Comments: cagattaatgaggtgatgc
ok
Proper citation: RRID:Addgene_30157 Copy
Genetic Insert: APP shRNA 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18160654
Comments: gcacatgaatgtgcagaatgg
Proper citation: RRID:Addgene_30134 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Size:6568; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein.
Additionally, the vector adds an MBP fusion to the N-terminus of your protein, which may help expression and solubility.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TACTTCCAATCCAATGCA3'
Reverse - 5' CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30185 Copy
Vector Backbone Description: Backbone Size:5380; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.
This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TACTTCCAATCCAATGCA3'
Reverse - 5' CTCCCACTACCAATGCC 3'
Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with SspI, then gel purify.
When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_30184 Copy
Genetic Insert: No gene
Vector Backbone Description: Backbone Size:2400; Vector Backbone:pENTR3C; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21415370
Comments: pENTR3c was re-engineered to allow fusion of flag-bio to the c-terminus of an ORF. The ORF is cloned in 5'-SalI-EcoRI-3'. The ccdb gene was removed. The fusion construct is transferred to a gateway destination vector by LR clonase.
Proper citation: RRID:Addgene_30216 Copy
Species: Thermus thermophilus HB27
Genetic Insert: lipoate protein ligase B
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18076036
Proper citation: RRID:Addgene_30165 Copy
Species: Archaeoglobus fulgidus
Genetic Insert: AF0623
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19478428
Proper citation: RRID:Addgene_30164 Copy
Species: Homo sapiens
Genetic Insert: HJURP CenpA Binding Domain
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pET42+b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21412236
Proper citation: RRID:Addgene_30393 Copy
Species: Homo sapiens
Genetic Insert: Ahi1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19718039
Comments: Total plasmid size: 8.4kb
Proper citation: RRID:Addgene_30495 Copy
Species: Bos taurus
Genetic Insert: Mature bovine mitochondrial elongation factor Tu
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET24c(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8547323
Proper citation: RRID:Addgene_30535 Copy
Species: Escherichia coli
Genetic Insert: beta-glucuronidase
Vector Backbone Description: Backbone Size:2792; Vector Backbone:pBAV1k; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22020504
Comments: In our experience, plasmid yields are highest when cells are harvested at late log stage.
Proper citation: RRID:Addgene_30501 Copy
Species: Escherichia coli
Genetic Insert: beta-glucuronidase
Vector Backbone Description: Backbone Size:2792; Vector Backbone:pBAV1k; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22020504
Comments: In our experience, plasmid yields are highest when cells are harvest at late log stage.
Proper citation: RRID:Addgene_30503 Copy
Species: Escherichia coli
Genetic Insert: beta-glucuronidase
Vector Backbone Description: Backbone Size:2792; Vector Backbone:pBAV1k; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22020504
Comments: In our experience, plasmid yields are highest when cells are harvested at late log stage.
Proper citation: RRID:Addgene_30502 Copy
Species: E. coli
Genetic Insert: E. coli elongation factor Ts
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET24c(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:8765000
Proper citation: RRID:Addgene_31173 Copy
Species: Homo sapiens
Genetic Insert: MEK
Vector Backbone Description: Backbone Size:2503; Vector Backbone:pME; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19269286
Comments: Middle entry clone.
Proper citation: RRID:Addgene_31166 Copy
Genetic Insert: chimeric fli1ep enhancer/promoter fragment
Vector Backbone Description: Backbone Size:2810; Vector Backbone:p5E; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17948311
Comments: "p5E" refers to 5' entry clones flanked by L4-R1.
Drives endothelial expression.
See publication for more details: Dev Dyn. 2007 Nov . 236(11):3077-87 PMID: 17948311 https://www.ncbi.nlm.nih.gov/pubmed/17948311
Proper citation: RRID:Addgene_31160 Copy
Genetic Insert: basal adenovirus E1b TATA element
Vector Backbone Description: Backbone Size:2810; Vector Backbone:p5E; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: "p5E" refers to 5' entry clones flanked by L4-R1
Proper citation: RRID:Addgene_31158 Copy
Species: Zea Mays
Genetic Insert: Auxin Signaling Repressor BIF1
Vector Backbone Description: Vector Backbone:pENTR; Vector Types:Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32123041
Proper citation: RRID:Addgene_188442 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
