Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pET MBP mOrange LIC cloning vector (MBP-mOrange) Resource Report Resource Website |
RRID:Addgene_29748 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. mOrange has a excitation max of 548 nm and an emission max of 562 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:23 | 0 | ||||
|
pET MBP mCherry LIC cloning vector (MBP-mCherry) Resource Report Resource Website 1+ mentions |
RRID:Addgene_29747 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. mCherry has a excitation max of 587 nm and an emission max of 610 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:7270; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:23 | 1 | ||||
|
pENTR APLP1 shRNA 2 Resource Report Resource Website |
RRID:Addgene_30157 | APLP1 shRNA 2 | Kanamycin | PMID:18573216 | cagattaatgaggtgatgc ok | Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:25 | 0 | ||
|
pENTR APP shRNA 1 Resource Report Resource Website |
RRID:Addgene_30134 | APP shRNA 1 | Kanamycin | PMID:18160654 | gcacatgaatgtgcagaatgg | Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:22 | 0 | ||
|
pET MBP-FlAsH LIC cloning vector (MBP-FlAsH) Resource Report Resource Website |
RRID:Addgene_30185 | None | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein. Additionally, the vector adds an MBP fusion to the N-terminus of your protein, which may help expression and solubility. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TACTTCCAATCCAATGCA3' Reverse - 5' CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:6568; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:26 | 0 | |||
|
pET Biotin His6 FlAsH LIC cloning vector (H6-FlAsH) Resource Report Resource Website 1+ mentions |
RRID:Addgene_30184 | Kanamycin | This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein. To clone into this vector, add LIC tags to the 5' end of your PCR primers. Forward - 5' TACTTCCAATCCAATGCA3' Reverse - 5' CTCCCACTACCAATGCC 3' Do NOT include a stop codon with your reverse primer. Linearize the plasmid with SspI, then gel purify. When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ | Backbone Size:5380; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:25 | 2 | ||||
|
pENTR-flbio Resource Report Resource Website |
RRID:Addgene_30216 | No gene | Kanamycin | PMID:21415370 | pENTR3c was re-engineered to allow fusion of flag-bio to the c-terminus of an ORF. The ORF is cloned in 5'-SalI-EcoRI-3'. The ccdb gene was removed. The fusion construct is transferred to a gateway destination vector by LR clonase. | Backbone Size:2400; Vector Backbone:pENTR3C; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:23 | 0 | ||
|
pET28b-LipB Resource Report Resource Website |
RRID:Addgene_30165 | lipoate protein ligase B | Thermus thermophilus HB27 | Kanamycin | PMID:18076036 | Backbone Size:5500; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:25 | 0 | ||
|
pET28b-AF0623 Resource Report Resource Website |
RRID:Addgene_30164 | AF0623 | Archaeoglobus fulgidus | Kanamycin | PMID:19478428 | Backbone Size:5500; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:25 | 0 | ||
|
pET-HJURP-CBP Resource Report Resource Website |
RRID:Addgene_30393 | HJURP CenpA Binding Domain | Homo sapiens | Kanamycin | PMID:21412236 | Backbone Size:6000; Vector Backbone:pET42+b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:25 | 0 | ||
|
pDsRed2-C1-Ahi1 Resource Report Resource Website |
RRID:Addgene_30495 | Ahi1 | Homo sapiens | Kanamycin | PMID:19718039 | Total plasmid size: 8.4kb | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed2-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:25 | 0 | |
|
pET24c(+)-mtEFTu Resource Report Resource Website 1+ mentions |
RRID:Addgene_30535 | Mature bovine mitochondrial elongation factor Tu | Bos taurus | Kanamycin | PMID:8547323 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET24c(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Mature form amino acids 44-452. Mito import sequence not included | 2026-08-15 01:13:29 | 1 | |
|
lacI-PT5-gusA-pBAV1k Resource Report Resource Website |
RRID:Addgene_30501 | beta-glucuronidase | Escherichia coli | Kanamycin | PMID:22020504 | In our experience, plasmid yields are highest when cells are harvested at late log stage. | Backbone Size:2792; Vector Backbone:pBAV1k; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:25 | 0 | |
|
lacI-Ptac-gusA-pBAV1k Resource Report Resource Website |
RRID:Addgene_30503 | beta-glucuronidase | Escherichia coli | Kanamycin | PMID:22020504 | In our experience, plasmid yields are highest when cells are harvest at late log stage. | Backbone Size:2792; Vector Backbone:pBAV1k; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:29 | 0 | |
|
araC-pBAD-gusA-pBAV1k Resource Report Resource Website |
RRID:Addgene_30502 | beta-glucuronidase | Escherichia coli | Kanamycin | PMID:22020504 | In our experience, plasmid yields are highest when cells are harvested at late log stage. | Backbone Size:2792; Vector Backbone:pBAV1k; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:29 | 0 | |
|
pET24c(+)-EFTs Resource Report Resource Website |
RRID:Addgene_31173 | E. coli elongation factor Ts | E. coli | Kanamycin | PMID:8765000 | Backbone Marker:Novagen; Backbone Size:5300; Vector Backbone:pET24c(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:32 | 0 | ||
|
782 pMEActMEK Resource Report Resource Website |
RRID:Addgene_31166 | MEK | Homo sapiens | Kanamycin | PMID:19269286 | Middle entry clone. | Backbone Size:2503; Vector Backbone:pME; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | Ser218Glu Ser222Asp; activated MEKK | 2026-08-15 01:13:29 | 0 |
|
478 p5Efli1ep Resource Report Resource Website 1+ mentions |
RRID:Addgene_31160 | chimeric fli1ep enhancer/promoter fragment | Kanamycin | PMID:17948311 | "p5E" refers to 5' entry clones flanked by L4-R1. Drives endothelial expression. See publication for more details: Dev Dyn. 2007 Nov . 236(11):3077-87 PMID: 17948311 https://www.ncbi.nlm.nih.gov/pubmed/17948311 | Backbone Size:2810; Vector Backbone:p5E; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:32 | 8 | ||
|
474 p5E-basprom Resource Report Resource Website |
RRID:Addgene_31158 | basal adenovirus E1b TATA element | Kanamycin | "p5E" refers to 5' entry clones flanked by L4-R1 | Backbone Size:2810; Vector Backbone:p5E; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:13:29 | 0 | |||
|
pENTR-BIF1 Resource Report Resource Website |
RRID:Addgene_188442 | Auxin Signaling Repressor BIF1 | Zea Mays | Kanamycin | PMID:32123041 | Vector Backbone:pENTR; Vector Types:Cloning; Bacterial Resistance:Kanamycin | 2026-08-15 01:23:39 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
