Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: BAF60b
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBlueScript SK(-); Vector Types:phagemid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8804307
Proper citation: RRID:Addgene_21035 Copy
Species: Homo sapiens
Genetic Insert: BAF60a
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBlueScript SK(-); Vector Types:phagemid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8804307
Proper citation: RRID:Addgene_21034 Copy
Species: Homo sapiens
Genetic Insert: pMyrPalm
Vector Backbone Description: Backbone Size:5904; Vector Backbone:IRES_puro2b; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19203582
Proper citation: RRID:Addgene_21038 Copy
Species: Homo sapiens
Genetic Insert: pMyrPalm
Vector Backbone Description: Backbone Size:4780; Vector Backbone:pmEGFP_C1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19203582
Proper citation: RRID:Addgene_21037 Copy
Species: Homo sapiens
Genetic Insert: BAF60c
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2961; Vector Backbone:pBlueScript SK(-); Vector Types:phagemid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8804307
Proper citation: RRID:Addgene_21036 Copy
Species: Homo sapiens
Genetic Insert: hPCNA
Vector Backbone Description: Backbone Size:6037; Vector Backbone:IRES_puro2b; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19203582
Proper citation: RRID:Addgene_21048 Copy
Species: Mus musculus
Genetic Insert: PRRX2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9665387
Proper citation: RRID:Addgene_21010 Copy
Species: Mus musculus
Genetic Insert: CBP
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4948; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11585930
Comments: The protein product of this clone exhibits good HAT activity on histone substrates.
Proper citation: RRID:Addgene_21093 Copy
Species: Mus musculus
Genetic Insert: MSX2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5376; Vector Backbone:pET-28c; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9373945
Proper citation: RRID:Addgene_21025 Copy
Species: Homo sapiens
Genetic Insert: miR-21
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1(+) (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19359480
Proper citation: RRID:Addgene_21114 Copy
Species: Homo sapiens
Genetic Insert: miR-17
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1(+) (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19359480
Proper citation: RRID:Addgene_21113 Copy
Species: Homo sapiens
Genetic Insert: miR-29b-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17204650
Proper citation: RRID:Addgene_21121 Copy
Species: Homo sapiens
Genetic Insert: von Hippel-Lindau tumor suppressor
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:7800; Vector Backbone:pESC-LEU; Vector Types:Yeast Expression, yeast/bacteria shuttle; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18756251
Proper citation: RRID:Addgene_21053 Copy
Species: Homo sapiens
Genetic Insert: miR-17-92 cluster
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15944709
Proper citation: RRID:Addgene_21109 Copy
Species: Homo sapiens
Genetic Insert: RNAi against hypoxia inducible factor 1alpha
Vector Backbone Description: Backbone Size:3300; Vector Backbone:PBS/U6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19131628
Comments: HIF1α RNAi target sequence: GAGCTTGCTCATCAGTTGCCA
Proper citation: RRID:Addgene_21103 Copy
Species: Gallus gallus
Genetic Insert: FAK
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_21155 Copy
Species: Homo sapiens
Genetic Insert: pcDNA3-HA-Sumo1
Vector Backbone Description: Vector Backbone:pcDNA3.1 HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15117942
Comments: This plasmid does not contain the BGH polyA terminator present in the standard pcDNA3 backbone. It is not known whether the removal of the terminator affects expression.
Proper citation: RRID:Addgene_21154 Copy
Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15342384
Proper citation: RRID:Addgene_21208 Copy
Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15342384
Comments: Constitutive active protein has the following aa sequence deleted - ALQKKLEELELDEQQRKRLE, residues 31 to 51.
Proper citation: RRID:Addgene_21207 Copy
Species: Homo sapiens
Genetic Insert: miR-17-5p Control
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5523; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15944709
Proper citation: RRID:Addgene_21166 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
