Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: bacteriophage
Genetic Insert: Cre recombinase
Vector Backbone Description: Backbone Size:6543; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20526348
Comments: Second AgeI site is introduced preventing AgeI-EcoRI shRNA subcloning. TRC library shRNAs can be subcloned as an AccI fragment.
Proper citation: RRID:Addgene_25997 Copy
Species: Homo sapiens
Genetic Insert: H2B-GFP
Vector Backbone Description: Backbone Size:6380; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20526348
Comments: Second AgeI site is introduced preventing AgeI-EcoRI shRNA subcloning. TRC library shRNAs can be subcloned as an AccI fragment or SphI-SacII fragment.
Proper citation: RRID:Addgene_25999 Copy
Genetic Insert: His-MBP-3C-lacZ
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5457; Vector Backbone:pTriEx-2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17317681
Comments: Promoters/baculoviral recombination sites: (T7lacO-not used), CMV enhancer and beta-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.
Proper citation: RRID:Addgene_26044 Copy
Genetic Insert: SS peptide-LacZ-KHHHHHH
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5457; Vector Backbone:pTriEx-2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17317681
Comments: Promoters/baculoviral recombination sites: (T7lacO-not used), CMV enhancer and beta-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.
Proper citation: RRID:Addgene_26046 Copy
Genetic Insert: His-lacZ-KHHHHHH
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5457; Vector Backbone:pTriEx-2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17317681
Comments: Promoters/baculoviral recombination sites: T7lacO, CMV enhancer and beta-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.
Proper citation: RRID:Addgene_26043 Copy
Genetic Insert: His3C-lacZ
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5457; Vector Backbone:pTriEx-2; Vector Types:Mammalian Expression, Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17317681
Comments: Promoters/baculoviral recombination sites: T7lacO, CMV enhancer and beta-actin promoter, p10 promoter/lef-2 and 1629 baculo elements.
Proper citation: RRID:Addgene_26042 Copy
Species: Mus musculus
Genetic Insert: L-Myc
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo; Backbone Size:6340; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20660764
Proper citation: RRID:Addgene_26023 Copy
Species: Homo sapiens
Genetic Insert: L-Myc
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura of the University of Tokyo; Backbone Size:6340; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20660764
Proper citation: RRID:Addgene_26022 Copy
Species: Homo sapiens
Genetic Insert: ATP-binding cassette, sub-family G (WHITE), member 2, variant of isoform 2
Vector Backbone Description: Backbone Marker:James Thomson; Backbone Size:6500; Vector Backbone:pSIN-EF2-MCS-IRES-Neo; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19670287
Comments: Please note that the backbone of this plasmid is larger than the reported 6.5kb (see attached diagnostic digest).
Proper citation: RRID:Addgene_25983 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:2946; Vector Backbone:p3E; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23462469
Comments: "p3E" refers to 3' entry clones flanked by R2-L3.
Proper citation: RRID:Addgene_26031 Copy
Genetic Insert: N terminal avi tag with RBS
Vector Backbone Description: Backbone Size:2646; Vector Backbone:pMLL-KA; Vector Types:Synthetic Biology, 2ab assembly vector; Bacterial Resistance:Ampicillin and Kanamycin
Comments: Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
Proper citation: RRID:Addgene_26008 Copy
Species: Mus musculus
Genetic Insert: Kinase suppressor of Ras 2
Vector Backbone Description: Backbone Size:6500; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19883615
Proper citation: RRID:Addgene_25969 Copy
Species: Homo sapiens
Genetic Insert: CD11b promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3199; Vector Backbone:pGEM3zf-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7811988
Comments: The cloned CD11b promoter in this construct contains some 5'UTR, including the transcription start site.
Proper citation: RRID:Addgene_26168 Copy
Species: Mycobacterium marinum + Photorhabdus luminescens
Genetic Insert: G13 promoter + Bacterial luciferase operon
Vector Backbone Description: Backbone Size:4373; Vector Backbone:pMV306hsp; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20520722
Comments: The sequence of the Lux operon is theoretical. As such, there are a few differences between Addgene sequence and full plasmid sequence. These differences do not affect plasmid function.
Qazi, S.N., et al., agr expression precedes escape of internalized Staphylococcus aureus from the host endosome. Infect Immun, 2001. 69(11): p. 7074-82.
Proper citation: RRID:Addgene_26160 Copy
Species: Mycobacterium bovis BCG
Genetic Insert: hsp60 promoter
Vector Backbone Description: Backbone Size:3938; Vector Backbone:pMV306; Vector Types:Mycobacteria integrating vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20520722
Comments: There are a few sequence discrepancies between author sequence and Addgene quality control sequence for the hsp promoter. The hsp promoter sequence was taken from the pSMT3 vector and is theoretical sequence. These differences do not affect function.
Garbe, T.R., et al., Transformation of mycobacterial species using hygromycin resistance as selectable marker. Microbiology, 1994. 140 ( Pt 1): p. 133-8.
Proper citation: RRID:Addgene_26155 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php
Proper citation: RRID:Addgene_26094 Copy
Species: trans-activator - KRAB
Genetic Insert: tTR-KRAB
Vector Backbone Description: Backbone Size:7569; Vector Backbone:pSin-EF2-Nanog; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22645348
Proper citation: RRID:Addgene_26122 Copy
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium; Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: The pET28-MHL vector (GenBank accession EF456735) was derived from expression plasmid pET28a-LIC (SGC). It is used for T7 promoter driven expression of recombinant proteins with the addition of an 18 amino acid N-terminal fusion tag containing 6X His followed by a TEV cleavage site. The GSS residues after the Met start site were removed to reduce N-terminal gluconoylation via preventing N-terminal Met excision. Two stop codons are included in the vector at the C-terminal cloning site.
Insertion of DNA sequence into the cloning/expression region is performed using BD-Biosciences Infusion enzyme mediated directional recombination between complementary 15 nucleotide DNA sequences at the ends of the insert (PCR product) and BseRI linearized vector. Insertion of target sequence involves replacement of a SacB gene stuffer sequence, which provides for negative selection of the original plasmid on 5% sucrose.
http://www.sgc.utoronto.ca/SGC-WebPages/toronto-vectors.php
Proper citation: RRID:Addgene_26096 Copy
Species: Schmidtea mediterranea
Genetic Insert: Smed-elav1
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript II SK(+); Vector Types:cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20844018
Proper citation: RRID:Addgene_26130 Copy
Vector Backbone Description: Backbone Marker:SGC Oxford; Backbone Size:7218; Vector Backbone:pNIC-CH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: pET expression vector with C-terminal His6 tag. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose. GenBank accession number: EF199843
Primers for LIC cloning:
Add the following 5’ extensions to the PCR primers:
Upstream: TTAAGAAGGAGATATACTATG (ATG-initiation codon)
Downstream: AATGGTGGTGATGATGGTGCGC
The purified PCR fragments are treated with T4 DNA polymerase and dGTP, then annealed to the treated vector. See supplemental document for more information.
Proper citation: RRID:Addgene_26117 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
